Incidental Mutation 'R1680:Rbl1'
ID188392
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene NameRB transcriptional corepressor like 1
Synonymsp107
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157145893-157204534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157174783 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 632 (L632P)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
Predicted Effect probably damaging
Transcript: ENSMUST00000029170
AA Change: L632P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: L632P

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154721
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0173:Rbl1 UTSW 2 157159685 missense probably benign 0.00
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1445:Rbl1 UTSW 2 157193098 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1666:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R2304:Rbl1 UTSW 2 157147631 missense probably benign 0.02
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
R7090:Rbl1 UTSW 2 157152900 missense probably benign 0.02
R7176:Rbl1 UTSW 2 157188325 missense probably damaging 1.00
R7769:Rbl1 UTSW 2 157191980 missense probably benign 0.01
R8032:Rbl1 UTSW 2 157187998 nonsense probably null
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGGTGAAAGCACTGAGCTTGTCAAA -3'
(R):5'- AACAGAGTCCCTTCCTGTGAAGAAGTA -3'

Sequencing Primer
(F):5'- gagagatggctcagcgg -3'
(R):5'- gagtgagtaggaagatggatagg -3'
Posted On2014-05-09