Mutagenetix > Incidental Mutations

Incidental Mutation 'R1680:Rbl1'

188392

Institutional Source

Beutler Lab

Gene Symbol

Rbl1

Ensembl Gene

ENSMUSG00000027641

Gene Name

RB transcriptional corepressor like 1

Synonyms

p107

MMRRC Submission

039716-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

157145893-157204534 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 157174783 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 632 (L632P)

Ref Sequence

ENSEMBL: ENSMUSP00000029170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029170]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029170
AA Change: L632P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: L632P

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
DUF3452	70	212	5.14e-78	SMART
RB_A	385	578	9.58e-119	SMART
low complexity region	706	719	N/A	INTRINSIC
CYCLIN	800	934	8.68e-6	SMART
Rb_C	947	1063	2.29e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154721

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Clstn1	T	C	4: 149,643,726	V617A	probably benign	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mertk	A	G	2: 128,801,636	D985G	probably benign	Het
Mical3	A	T	6: 120,959,643	S1307R	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Plxnc1	A	C	10: 94,841,551	L938R	probably benign	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tfcp2l1	T	A	1: 118,675,605	F458I	probably damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Rbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Rbl1	APN	2	157152892	splice site	probably null
IGL01418:Rbl1	APN	2	157152892	splice site	probably null
IGL01597:Rbl1	APN	2	157195449	splice site	probably benign
IGL01788:Rbl1	APN	2	157163656	missense	probably benign	0.15
IGL02366:Rbl1	APN	2	157174893	missense	probably benign	0.18
IGL02527:Rbl1	APN	2	157194048	missense	probably benign	0.05
IGL02720:Rbl1	APN	2	157199429	missense	possibly damaging	0.94
IGL02828:Rbl1	APN	2	157199464	missense	probably damaging	1.00
IGL02926:Rbl1	APN	2	157167413	missense	probably benign	0.08
IGL02968:Rbl1	APN	2	157177274	missense	probably damaging	1.00
IGL03284:Rbl1	APN	2	157194069	splice site	probably benign
R0042:Rbl1	UTSW	2	157175704	splice site	probably benign
R0089:Rbl1	UTSW	2	157199414	critical splice donor site	probably null
R0173:Rbl1	UTSW	2	157159685	missense	probably benign	0.00
R0464:Rbl1	UTSW	2	157147545	missense	probably damaging	1.00
R1178:Rbl1	UTSW	2	157147655	missense	possibly damaging	0.92
R1296:Rbl1	UTSW	2	157169971	missense	probably benign	0.09
R1430:Rbl1	UTSW	2	157169906	missense	probably benign
R1445:Rbl1	UTSW	2	157193098	missense	probably benign
R1511:Rbl1	UTSW	2	157195634	missense	probably damaging	1.00
R1603:Rbl1	UTSW	2	157175659	missense	possibly damaging	0.75
R1666:Rbl1	UTSW	2	157159734	missense	probably damaging	1.00
R1668:Rbl1	UTSW	2	157159734	missense	probably damaging	1.00
R1771:Rbl1	UTSW	2	157163534	splice site	probably null
R1833:Rbl1	UTSW	2	157195555	missense	probably damaging	0.98
R1852:Rbl1	UTSW	2	157174903	missense	probably benign	0.01
R2304:Rbl1	UTSW	2	157147631	missense	probably benign	0.02
R3552:Rbl1	UTSW	2	157195585	missense	probably benign	0.19
R3605:Rbl1	UTSW	2	157177233	missense	probably damaging	1.00
R3607:Rbl1	UTSW	2	157177233	missense	probably damaging	1.00
R4160:Rbl1	UTSW	2	157192119	intron	probably benign
R4423:Rbl1	UTSW	2	157168955	intron	probably benign
R4636:Rbl1	UTSW	2	157167420	missense	possibly damaging	0.82
R4780:Rbl1	UTSW	2	157174804	missense	probably benign	0.43
R4789:Rbl1	UTSW	2	157177355	missense	probably benign
R5145:Rbl1	UTSW	2	157175477	intron	probably benign
R5802:Rbl1	UTSW	2	157161433	missense	probably benign	0.23
R5851:Rbl1	UTSW	2	157167325	missense	probably benign	0.00
R6742:Rbl1	UTSW	2	157169998	missense	probably benign	0.19
R6861:Rbl1	UTSW	2	157152967	missense	probably damaging	1.00
R6943:Rbl1	UTSW	2	157188286	missense	probably benign
R7090:Rbl1	UTSW	2	157152900	missense	probably benign	0.02
R7176:Rbl1	UTSW	2	157188325	missense	probably damaging	1.00
R7769:Rbl1	UTSW	2	157191980	missense	probably benign	0.01
R8032:Rbl1	UTSW	2	157187998	nonsense	probably null
X0057:Rbl1	UTSW	2	157188329	nonsense	probably null
X0058:Rbl1	UTSW	2	157174813	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GGGTGAAAGCACTGAGCTTGTCAAA -3'
(R):5'- AACAGAGTCCCTTCCTGTGAAGAAGTA -3'

Sequencing Primer
(F):5'- gagagatggctcagcgg -3'
(R):5'- gagtgagtaggaagatggatagg -3'

Posted On

2014-05-09