Incidental Mutation 'R1680:Npnt'
ID 188396
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Name nephronectin
Synonyms 1110009H02Rik, POEM
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 132881745-132950291 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132906802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000112816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
AlphaFold Q91V88
Predicted Effect probably benign
Transcript: ENSMUST00000042729
AA Change: V195A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042744
AA Change: V178A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093971
AA Change: V226A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: V226A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117164
AA Change: V209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: V209A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117456
AA Change: V74A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998
AA Change: V74A

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117811
AA Change: V178A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132732
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132904657 critical splice donor site probably null
IGL01457:Npnt APN 3 132885982 missense probably damaging 1.00
IGL01954:Npnt APN 3 132909963 missense probably damaging 1.00
IGL01999:Npnt APN 3 132908399 missense probably damaging 1.00
IGL02012:Npnt APN 3 132908397 missense probably damaging 1.00
IGL02025:Npnt APN 3 132890762 critical splice donor site probably null
IGL02637:Npnt APN 3 132884510 missense possibly damaging 0.90
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R1729:Npnt UTSW 3 132914397 nonsense probably null
R1773:Npnt UTSW 3 132904693 missense possibly damaging 0.62
R1980:Npnt UTSW 3 132948132 missense probably benign 0.04
R1982:Npnt UTSW 3 132948132 missense probably benign 0.04
R2338:Npnt UTSW 3 132891409 missense probably damaging 1.00
R3800:Npnt UTSW 3 132906763 missense probably damaging 1.00
R4739:Npnt UTSW 3 132904691 missense possibly damaging 0.93
R4790:Npnt UTSW 3 132890762 critical splice donor site probably benign
R5008:Npnt UTSW 3 132906457 missense probably damaging 1.00
R5446:Npnt UTSW 3 132908369 missense probably damaging 1.00
R5471:Npnt UTSW 3 132914387 missense probably benign 0.05
R5538:Npnt UTSW 3 132904963 missense probably damaging 1.00
R5673:Npnt UTSW 3 132917497 missense probably damaging 0.97
R5683:Npnt UTSW 3 132906840 splice site probably null
R5827:Npnt UTSW 3 132906775 missense possibly damaging 0.89
R5857:Npnt UTSW 3 132908349 missense probably damaging 1.00
R5910:Npnt UTSW 3 132906418 missense probably damaging 1.00
R6208:Npnt UTSW 3 132950013 unclassified probably benign
R6358:Npnt UTSW 3 132904718 missense probably benign 0.18
R6875:Npnt UTSW 3 132909910 missense probably damaging 1.00
R7025:Npnt UTSW 3 132908396 missense probably damaging 1.00
R7145:Npnt UTSW 3 132909931 missense probably benign 0.01
R7166:Npnt UTSW 3 132948128 missense probably damaging 1.00
R7287:Npnt UTSW 3 132906802 missense probably benign 0.00
R7344:Npnt UTSW 3 132908339 splice site probably null
R8344:Npnt UTSW 3 132908456 missense probably damaging 1.00
R8717:Npnt UTSW 3 132908375 missense probably damaging 1.00
R8873:Npnt UTSW 3 132950055 start gained probably benign
R8903:Npnt UTSW 3 132886003 missense probably damaging 1.00
R9414:Npnt UTSW 3 132906355 missense probably benign 0.00
R9420:Npnt UTSW 3 132948105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACAGCATTACAGAGGTCCCCAG -3'
(R):5'- TGGTTGTGAGCGCAGAAGAATTCAG -3'

Sequencing Primer
(F):5'- GGTAACATTGCTCATTCAGTGC -3'
(R):5'- CGCAGAAGAATTCAGTTTAAGAGG -3'
Posted On 2014-05-09