Mutagenetix > Incidental Mutation

Incidental Mutation 'R1680:Clstn1'

188400

Institutional Source

Beutler Lab

Gene Symbol

Clstn1

Ensembl Gene

ENSMUSG00000039953

Gene Name

calsyntenin 1

Synonyms

Cst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha

MMRRC Submission

039716-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

149586468-149648899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149643726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 617 (V617A)

Ref Sequence

ENSEMBL: ENSMUSP00000101316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]

AlphaFold

Q9EPL2

Predicted Effect

probably benign
Transcript: ENSMUST00000039144
AA Change: V627A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: V627A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105691
AA Change: V617A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: V617A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mertk	A	G	2: 128,801,636	D985G	probably benign	Het
Mical3	A	T	6: 120,959,643	S1307R	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Plxnc1	A	C	10: 94,841,551	L938R	probably benign	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rbl1	A	G	2: 157,174,783	L632P	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tfcp2l1	T	A	1: 118,675,605	F458I	probably damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Clstn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clstn1	APN	4	149635243	missense	probably damaging	0.99
IGL00585:Clstn1	APN	4	149638312	missense	probably benign	0.05
IGL00911:Clstn1	APN	4	149643191	splice site	probably benign
IGL01394:Clstn1	APN	4	149634782	missense	possibly damaging	0.87
IGL02193:Clstn1	APN	4	149645352	missense	probably benign	0.03
IGL02406:Clstn1	APN	4	149627359	missense	probably damaging	1.00
IGL02501:Clstn1	APN	4	149631842	missense	probably damaging	1.00
IGL02641:Clstn1	APN	4	149629511	missense	probably null	1.00
R0012:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0020:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0021:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0026:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0031:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0038:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0062:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0064:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0193:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0279:Clstn1	UTSW	4	149643674	missense	probably damaging	1.00
R0394:Clstn1	UTSW	4	149644178	missense	probably benign	0.00
R0609:Clstn1	UTSW	4	149629300	splice site	probably null
R0685:Clstn1	UTSW	4	149646855	missense	probably benign	0.24
R0724:Clstn1	UTSW	4	149643624	missense	possibly damaging	0.84
R1016:Clstn1	UTSW	4	149646829	missense	probably benign	0.21
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1622:Clstn1	UTSW	4	149629407	missense	probably damaging	0.97
R3803:Clstn1	UTSW	4	149635339	missense	probably damaging	0.99
R3836:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R3838:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R4923:Clstn1	UTSW	4	149645029	missense	probably benign	0.07
R5024:Clstn1	UTSW	4	149635294	missense	possibly damaging	0.91
R5919:Clstn1	UTSW	4	149635246	missense	probably damaging	1.00
R6269:Clstn1	UTSW	4	149644067	missense	probably benign	0.00
R6354:Clstn1	UTSW	4	149643216	missense	probably benign	0.05
R6382:Clstn1	UTSW	4	149626120	splice site	probably null
R6573:Clstn1	UTSW	4	149643689	missense	probably damaging	1.00
R7342:Clstn1	UTSW	4	149629430	missense	probably damaging	0.98
R7457:Clstn1	UTSW	4	149634916	missense	probably benign	0.03
R7571:Clstn1	UTSW	4	149646287	missense	probably benign	0.38
R7682:Clstn1	UTSW	4	149626101	missense	possibly damaging	0.72
R7738:Clstn1	UTSW	4	149635354	missense	probably damaging	1.00
R7803:Clstn1	UTSW	4	149631871	missense	probably damaging	1.00
R7904:Clstn1	UTSW	4	149614137	missense	probably benign	0.01
R7918:Clstn1	UTSW	4	149644051	missense	probably damaging	0.98
R8007:Clstn1	UTSW	4	149631848	missense	probably damaging	1.00
R8821:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R8831:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R9169:Clstn1	UTSW	4	149646865	missense	possibly damaging	0.68
R9173:Clstn1	UTSW	4	149626107	missense	probably benign	0.08
R9463:Clstn1	UTSW	4	149614107	missense	possibly damaging	0.92
R9491:Clstn1	UTSW	4	149647472	missense	probably damaging	1.00
R9615:Clstn1	UTSW	4	149638300	missense	probably damaging	1.00
X0020:Clstn1	UTSW	4	149635251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCCCTGAAGATGCCAACAGAG -3'
(R):5'- TGGTCAGTACATATCCCACGCCTC -3'

Sequencing Primer
(F):5'- TCTTGGGGACTAAACAGCTTC -3'
(R):5'- TCATTCAGCTTCCCCAGATCAAG -3'

Posted On

2014-05-09