Incidental Mutation 'R1680:Slc5a6'
ID 188401
Institutional Source Beutler Lab
Gene Symbol Slc5a6
Ensembl Gene ENSMUSG00000006641
Gene Name solute carrier family 5 (sodium-dependent vitamin transporter), member 6
Synonyms
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 31036036-31048924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31042644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 131 (Y131H)
Ref Sequence ENSEMBL: ENSMUSP00000143993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080431] [ENSMUST00000114668] [ENSMUST00000200816] [ENSMUST00000202520] [ENSMUST00000202556] [ENSMUST00000202984]
AlphaFold Q5U4D8
Predicted Effect probably damaging
Transcript: ENSMUST00000080431
AA Change: Y131H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079291
Gene: ENSMUSG00000006641
AA Change: Y131H

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114668
AA Change: Y131H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110316
Gene: ENSMUSG00000006641
AA Change: Y131H

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200816
SMART Domains Protein: ENSMUSP00000144665
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201017
Predicted Effect probably damaging
Transcript: ENSMUST00000202520
AA Change: Y131H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143938
Gene: ENSMUSG00000006641
AA Change: Y131H

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202556
AA Change: Y131H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143993
Gene: ENSMUSG00000006641
AA Change: Y131H

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202984
SMART Domains Protein: ENSMUSP00000144349
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
Pfam:SSF 2 104 6.3e-15 PFAM
transmembrane domain 158 180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Slc5a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Slc5a6 APN 5 31038935 unclassified probably benign
IGL02305:Slc5a6 APN 5 31037835 missense probably benign 0.01
IGL02457:Slc5a6 APN 5 31040658 missense probably damaging 1.00
IGL02691:Slc5a6 APN 5 31042174 missense probably damaging 0.99
IGL02737:Slc5a6 APN 5 31037167 missense probably benign 0.01
IGL03277:Slc5a6 APN 5 31038028 missense possibly damaging 0.90
IGL03389:Slc5a6 APN 5 31037477 missense probably damaging 1.00
Burke UTSW 5 31036884 nonsense probably null
whig UTSW 5 31036811 missense probably damaging 1.00
F5770:Slc5a6 UTSW 5 31042613 splice site probably null
R1177:Slc5a6 UTSW 5 31039302 critical splice donor site probably null
R1505:Slc5a6 UTSW 5 31037111 missense probably benign 0.00
R1800:Slc5a6 UTSW 5 31040676 nonsense probably null
R1881:Slc5a6 UTSW 5 31036811 missense probably damaging 1.00
R2216:Slc5a6 UTSW 5 31039335 missense possibly damaging 0.77
R3803:Slc5a6 UTSW 5 31042951 missense probably damaging 1.00
R4250:Slc5a6 UTSW 5 31037718 missense probably benign 0.00
R4765:Slc5a6 UTSW 5 31038083 missense possibly damaging 0.85
R4821:Slc5a6 UTSW 5 31036884 nonsense probably null
R5187:Slc5a6 UTSW 5 31042978 missense probably damaging 1.00
R5536:Slc5a6 UTSW 5 31043102 missense probably damaging 1.00
R5554:Slc5a6 UTSW 5 31038100 missense probably damaging 0.98
R5806:Slc5a6 UTSW 5 31040770 missense probably damaging 1.00
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6615:Slc5a6 UTSW 5 31036830 missense probably benign
R6621:Slc5a6 UTSW 5 31040778 missense probably damaging 0.98
R6983:Slc5a6 UTSW 5 31040405 missense probably benign
R7989:Slc5a6 UTSW 5 31042136 critical splice donor site probably null
R8433:Slc5a6 UTSW 5 31037462 missense possibly damaging 0.54
R9180:Slc5a6 UTSW 5 31037846 missense probably damaging 0.97
R9390:Slc5a6 UTSW 5 31040459 missense possibly damaging 0.65
V7581:Slc5a6 UTSW 5 31042613 splice site probably null
X0022:Slc5a6 UTSW 5 31043338 start codon destroyed probably null 0.97
Z1176:Slc5a6 UTSW 5 31038025 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCAGTTTGAGAGCAGGGAGACC -3'
(R):5'- GAGCAGAACAGGATGACTTCCCAG -3'

Sequencing Primer
(F):5'- AGAGCAGGGAGACCTCCAC -3'
(R):5'- TGACTTCCCAGTACAGGGATG -3'
Posted On 2014-05-09