Incidental Mutation 'R1680:Gucy2c'
ID188412
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136722493 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 617 (S617P)
Ref Sequence ENSEMBL: ENSMUSP00000032338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect probably damaging
Transcript: ENSMUST00000032338
AA Change: S617P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: S617P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078095
AA Change: S593P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: S593P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136722420 missense probably damaging 0.99
R0880:Gucy2c UTSW 6 136709832 critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1487:Gucy2c UTSW 6 136748826 missense possibly damaging 0.79
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136708366 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136740686 nonsense probably null
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
R7822:Gucy2c UTSW 6 136708406 missense probably damaging 1.00
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Z1177:Gucy2c UTSW 6 136719687 missense probably damaging 1.00
Z1177:Gucy2c UTSW 6 136767196 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAGCCGAATACCGAAAACAGTG -3'
(R):5'- ACGGCCACACGTACAGAGAAATTG -3'

Sequencing Primer
(F):5'- gcctgatgccctcttctg -3'
(R):5'- ACAGAGAAATTGATTCAAAATGTCAC -3'
Posted On2014-05-09