Incidental Mutation 'R1680:Bcat1'
ID188414
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Namebranched chain aminotransferase 1, cytosolic
SynonymsEca39, Bcat-1, BCATc
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location144993835-145076184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 145039628 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 96 (D96A)
Ref Sequence ENSEMBL: ENSMUSP00000032402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]
Predicted Effect probably damaging
Transcript: ENSMUST00000032402
AA Change: D96A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: D96A

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048252
AA Change: D29A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: D29A

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111742
AA Change: D29A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: D29A

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123930
AA Change: D28A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268
AA Change: D28A

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145911
Predicted Effect probably damaging
Transcript: ENSMUST00000149769
AA Change: D4A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268
AA Change: D4A

DomainStartEndE-ValueType
PDB:2ABJ|J 2 136 1e-78 PDB
SCOP:d1ekfa_ 2 136 1e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154611
SMART Domains Protein: ENSMUSP00000123137
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 1 84 2e-46 PDB
SCOP:d1ekfa_ 1 84 4e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155693
SMART Domains Protein: ENSMUSP00000116565
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 1 112 8e-64 PDB
SCOP:d1ekfa_ 1 112 2e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158242
Predicted Effect probably benign
Transcript: ENSMUST00000204138
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 145000289 missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 145004409 missense probably damaging 1.00
IGL02021:Bcat1 APN 6 145047289 splice site probably benign
IGL02024:Bcat1 APN 6 145032838 missense probably damaging 0.97
IGL02705:Bcat1 APN 6 145019188 splice site probably benign
IGL02954:Bcat1 APN 6 145019219 missense probably damaging 1.00
R0331:Bcat1 UTSW 6 145047314 missense probably benign 0.17
R1592:Bcat1 UTSW 6 145010058 missense probably benign 0.00
R2162:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R2306:Bcat1 UTSW 6 145007653 missense probably damaging 0.96
R3498:Bcat1 UTSW 6 145019342 missense probably damaging 0.99
R3758:Bcat1 UTSW 6 145032872 missense probably damaging 1.00
R3831:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R3833:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R4829:Bcat1 UTSW 6 145015475 missense probably damaging 1.00
R5250:Bcat1 UTSW 6 145047439 critical splice donor site probably null
R5338:Bcat1 UTSW 6 145007627 missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 145015447 critical splice donor site probably null
R5679:Bcat1 UTSW 6 145007748 missense probably damaging 1.00
R6566:Bcat1 UTSW 6 145015484 missense probably damaging 1.00
R7015:Bcat1 UTSW 6 145039583 missense probably damaging 0.99
R7255:Bcat1 UTSW 6 145032785 nonsense probably null
R7606:Bcat1 UTSW 6 145048632 missense probably benign 0.06
RF004:Bcat1 UTSW 6 145007623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCACAGCGTAGTGCAAAACAG -3'
(R):5'- TCCACAGTCTTTCAGTGGTCAAACC -3'

Sequencing Primer
(F):5'- TAGTGCAAAACAGAGGCAGC -3'
(R):5'- TCAGACACCCCCAGTGTTAA -3'
Posted On2014-05-09