Incidental Mutation 'R1680:Zfp606'
ID188416
Institutional Source Beutler Lab
Gene Symbol Zfp606
Ensembl Gene ENSMUSG00000030386
Gene Namezinc finger protein 606
Synonyms2410022M24Rik
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12478293-12496235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12493971 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 615 (H615L)
Ref Sequence ENSEMBL: ENSMUSP00000148075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098822] [ENSMUST00000151933] [ENSMUST00000209403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098822
AA Change: H673L

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096421
Gene: ENSMUSG00000030386
AA Change: H673L

DomainStartEndE-ValueType
KRAB 63 123 3.36e-39 SMART
ZnF_C2H2 291 313 1.83e2 SMART
ZnF_C2H2 403 425 2.89e1 SMART
ZnF_C2H2 431 453 2.3e-5 SMART
ZnF_C2H2 459 481 1.28e-3 SMART
ZnF_C2H2 487 509 3.95e-4 SMART
ZnF_C2H2 515 537 5.67e-5 SMART
ZnF_C2H2 543 565 6.88e-4 SMART
ZnF_C2H2 571 593 9.22e-5 SMART
ZnF_C2H2 599 621 1.95e-3 SMART
ZnF_C2H2 627 649 1.47e-3 SMART
ZnF_C2H2 655 677 3.39e-3 SMART
ZnF_C2H2 683 705 4.11e-2 SMART
ZnF_C2H2 711 733 4.87e-4 SMART
ZnF_C2H2 739 761 1.67e-2 SMART
ZnF_C2H2 767 789 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133515
Predicted Effect probably benign
Transcript: ENSMUST00000151933
SMART Domains Protein: ENSMUSP00000122197
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 5 65 3.36e-39 SMART
ZnF_C2H2 233 255 1.83e2 SMART
ZnF_C2H2 345 367 2.89e1 SMART
ZnF_C2H2 373 395 2.3e-5 SMART
ZnF_C2H2 401 423 1.28e-3 SMART
ZnF_C2H2 429 451 3.95e-4 SMART
ZnF_C2H2 457 479 5.67e-5 SMART
ZnF_C2H2 485 507 6.88e-4 SMART
ZnF_C2H2 513 535 9.22e-5 SMART
ZnF_C2H2 541 563 1.95e-3 SMART
ZnF_C2H2 569 591 1.47e-3 SMART
ZnF_C2H2 597 619 3.39e-3 SMART
ZnF_C2H2 625 647 4.11e-2 SMART
ZnF_C2H2 653 675 4.87e-4 SMART
ZnF_C2H2 681 703 1.67e-2 SMART
ZnF_C2H2 709 731 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209403
AA Change: H615L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein containing a Kruppel-associated box (KRAB) domain at its N-terminus, followed by contiguous C2H2 zinc finger motifs. The encoded protein is a nuclear protein that can act as a transcriptional repressor of growth factor-mediated signaling pathways in a reporter gene assay. This protein has been shown to interact with the SRY-box 9 gene product, and suppresses its transcriptional activity by inhibiting its DNA binding activity. Reduced expression of this gene promotes chondrocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Zfp606
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1861:Zfp606 UTSW 7 12480931 unclassified probably benign
R1943:Zfp606 UTSW 7 12493688 missense probably damaging 1.00
R2142:Zfp606 UTSW 7 12479726 missense probably damaging 0.99
R2340:Zfp606 UTSW 7 12493089 missense possibly damaging 0.91
R3426:Zfp606 UTSW 7 12489664 missense probably damaging 0.99
R4208:Zfp606 UTSW 7 12494175 missense probably damaging 1.00
R4258:Zfp606 UTSW 7 12494340 unclassified probably null
R4383:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R4393:Zfp606 UTSW 7 12492849 missense probably damaging 1.00
R4782:Zfp606 UTSW 7 12494005 missense probably damaging 1.00
R4858:Zfp606 UTSW 7 12493056 missense possibly damaging 0.89
R5668:Zfp606 UTSW 7 12492552 missense probably benign 0.28
R5704:Zfp606 UTSW 7 12493529 missense probably damaging 0.99
R6064:Zfp606 UTSW 7 12481033 missense possibly damaging 0.82
R6080:Zfp606 UTSW 7 12494116 missense probably damaging 1.00
R6190:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R6383:Zfp606 UTSW 7 12492944 missense probably benign 0.18
R6964:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7193:Zfp606 UTSW 7 12494039 missense probably benign 0.32
R7507:Zfp606 UTSW 7 12492941 missense probably benign 0.18
R7997:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7997:Zfp606 UTSW 7 12494207 missense possibly damaging 0.86
Z1176:Zfp606 UTSW 7 12481025 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGAACGGACAcacactggagtaa -3'
(R):5'- TTTCTGATGTTGAAGTAAGGCCGAATGA -3'

Sequencing Primer
(F):5'- agttcccatctcattgccc -3'
(R):5'- gtttctcgccactatgcattc -3'
Posted On2014-05-09