Incidental Mutation 'R1680:Olfr556'
ID 188420
Institutional Source Beutler Lab
Gene Symbol Olfr556
Ensembl Gene ENSMUSG00000073969
Gene Name olfactory receptor 556
Synonyms MOR41-1, GA_x6K02T2PBJ9-5386601-5387575
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102664899-102673270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102670733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000150289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098219] [ENSMUST00000213485] [ENSMUST00000217526]
AlphaFold E9Q549
Predicted Effect possibly damaging
Transcript: ENSMUST00000098219
AA Change: D271G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095822
Gene: ENSMUSG00000073969
AA Change: D271G

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.2e-85 PFAM
Pfam:7TM_GPCR_Srsx 39 192 1.5e-13 PFAM
Pfam:7tm_1 45 297 3.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213485
AA Change: D271G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217526
AA Change: D271G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Olfr556
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr556 APN 7 102670651 missense probably damaging 1.00
IGL01662:Olfr556 APN 7 102670720 missense probably damaging 1.00
IGL02989:Olfr556 APN 7 102670444 missense possibly damaging 0.50
R0194:Olfr556 UTSW 7 102670199 missense probably benign 0.01
R1670:Olfr556 UTSW 7 102670402 missense possibly damaging 0.72
R1711:Olfr556 UTSW 7 102670162 missense probably damaging 0.98
R1768:Olfr556 UTSW 7 102670301 missense probably damaging 1.00
R1950:Olfr556 UTSW 7 102670477 missense probably benign 0.03
R4452:Olfr556 UTSW 7 102670049 missense probably benign 0.00
R5564:Olfr556 UTSW 7 102670226 missense probably damaging 1.00
R6623:Olfr556 UTSW 7 102670034 missense possibly damaging 0.90
R7040:Olfr556 UTSW 7 102670730 missense probably benign 0.00
R7244:Olfr556 UTSW 7 102669839 start gained probably benign
R7300:Olfr556 UTSW 7 102670210 missense probably benign 0.01
R8499:Olfr556 UTSW 7 102670805 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATGCCCAGCAGTCTCTACAGTTTG -3'
(R):5'- TGTTATGCCAGGACACTCTACGCC -3'

Sequencing Primer
(F):5'- AGCAGTCTCTACAGTTTGATTTTTTC -3'
(R):5'- ATCCTTGCAGTGACTGGAAC -3'
Posted On 2014-05-09