Incidental Mutation 'R1680:Col5a3'
ID188423
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Namecollagen, type V, alpha 3
SynonymsPro-alpha3(V)
MMRRC Submission 039716-MU
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R1680 (G1)
Quality Score156
Status Not validated
Chromosome9
Chromosomal Location20770050-20815067 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 20784668 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145974
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0357:Col5a3 UTSW 9 20807768 splice site probably benign
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2149:Col5a3 UTSW 9 20771270 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4598:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4713:Col5a3 UTSW 9 20793574 missense unknown
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7431:Col5a3 UTSW 9 20770835 makesense probably null
R7500:Col5a3 UTSW 9 20800289 missense unknown
R7592:Col5a3 UTSW 9 20797393 missense unknown
R7671:Col5a3 UTSW 9 20775086 critical splice acceptor site probably null
Z1177:Col5a3 UTSW 9 20775334 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGGCTGATGTCTGGAATCATCCC -3'
(R):5'- TGACCTGGAGTGGACAGATCTACAG -3'

Sequencing Primer
(F):5'- gccagcactctgtcccc -3'
(R):5'- GTGGACAGATCTACAGAACTCACG -3'
Posted On2014-05-09