Incidental Mutation 'R1680:Olfr936'
ID188424
Institutional Source Beutler Lab
Gene Symbol Olfr936
Ensembl Gene ENSMUSG00000095194
Gene Nameolfactory receptor 936
SynonymsEG628171, GA_x6K02T2PVTD-32743332-32742397, MOR171-37
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39046614-39047549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39047000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000137209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178303] [ENSMUST00000216912]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104850
Predicted Effect probably benign
Transcript: ENSMUST00000178303
AA Change: I140V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137209
Gene: ENSMUSG00000095194
AA Change: I140V

DomainStartEndE-ValueType
Pfam:7tm_1 1 246 6e-21 PFAM
Pfam:7tm_4 1 264 6.9e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000216912
AA Change: Y184C
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Olfr936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Olfr936 APN 9 39047413 missense unknown
R0086:Olfr936 UTSW 9 39046895 missense probably benign 0.00
R0561:Olfr936 UTSW 9 39047373 missense probably damaging 0.99
R0650:Olfr936 UTSW 9 39046700 missense probably benign 0.01
R1221:Olfr936 UTSW 9 39047187 missense probably damaging 1.00
R1384:Olfr936 UTSW 9 39046904 missense possibly damaging 0.70
R1733:Olfr936 UTSW 9 39047382 missense unknown
R3767:Olfr936 UTSW 9 39047411 missense unknown
R4786:Olfr936 UTSW 9 39047487 nonsense probably null
R4944:Olfr936 UTSW 9 39046862 missense probably damaging 1.00
R5186:Olfr936 UTSW 9 39046969 nonsense probably null
R5403:Olfr936 UTSW 9 39046703 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6156:Olfr936 UTSW 9 39047375 missense possibly damaging 0.90
R6217:Olfr936 UTSW 9 39046743 makesense probably null
R6711:Olfr936 UTSW 9 39046866 makesense probably null
R6919:Olfr936 UTSW 9 39047531 utr 5 prime probably benign
R7022:Olfr936 UTSW 9 39047083 nonsense probably null
R7275:Olfr936 UTSW 9 39047519 utr 5 prime probably benign
R7290:Olfr936 UTSW 9 39047398 missense unknown
R7644:Olfr936 UTSW 9 39047342 missense probably damaging 1.00
Z1176:Olfr936 UTSW 9 39046919 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGGCAGTGACCACCAAGAAGAA -3'
(R):5'- TGCTGGCTGCAATGGCATATGA -3'

Sequencing Primer
(F):5'- CCTTGTTCCTCAGACTGTAGATTAGG -3'
(R):5'- GCATATGATCGCTATGTTGCC -3'
Posted On2014-05-09