Mutagenetix > Incidental Mutations

Incidental Mutation 'R1680:Plxnc1'

188432

Institutional Source

Beutler Lab

Gene Symbol

Plxnc1

Ensembl Gene

ENSMUSG00000074785

Gene Name

plexin C1

Synonyms

CD232, vespr, 2510048K12Rik

MMRRC Submission

039716-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.360) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94790866-94944835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 94841551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 938 (L938R)

Ref Sequence

ENSEMBL: ENSMUSP00000096939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099337]

AlphaFold

Q9QZC2

Predicted Effect

probably benign
Transcript: ENSMUST00000099337
AA Change: L938R

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: L938R

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Sema	87	431	5.5e-10	PFAM
PSI	454	507	5.28e-12	SMART
PSI	590	634	1.07e-3	SMART
Pfam:TIG	665	752	3.7e-9	PFAM
IPT	755	847	5.14e-7	SMART
IPT	849	954	1.8e-2	SMART
low complexity region	978	997	N/A	INTRINSIC
Pfam:Plexin_cytopl	1018	1541	1.4e-199	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180514

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Clstn1	T	C	4: 149,643,726	V617A	probably benign	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mertk	A	G	2: 128,801,636	D985G	probably benign	Het
Mical3	A	T	6: 120,959,643	S1307R	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rbl1	A	G	2: 157,174,783	L632P	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tfcp2l1	T	A	1: 118,675,605	F458I	probably damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Plxnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Plxnc1	APN	10	94847549	missense	probably benign	0.25
IGL01285:Plxnc1	APN	10	94799368	missense	probably damaging	0.99
IGL01867:Plxnc1	APN	10	94798146	missense	possibly damaging	0.61
IGL01994:Plxnc1	APN	10	94849939	missense	probably damaging	1.00
IGL02083:Plxnc1	APN	10	94922725	missense	possibly damaging	0.61
IGL02250:Plxnc1	APN	10	94871031	missense	probably benign	0.00
IGL02429:Plxnc1	APN	10	94882591	missense	probably benign	0.00
IGL02752:Plxnc1	APN	10	94794680	splice site	probably null
IGL02973:Plxnc1	APN	10	94810684	missense	probably damaging	1.00
R0230:Plxnc1	UTSW	10	94799347	missense	probably benign	0.07
R0265:Plxnc1	UTSW	10	94813129	missense	probably benign	0.14
R0271:Plxnc1	UTSW	10	94837918	missense	probably null	1.00
R0299:Plxnc1	UTSW	10	94849821	critical splice donor site	probably null
R0361:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
R0441:Plxnc1	UTSW	10	94796482	missense	probably damaging	1.00
R0558:Plxnc1	UTSW	10	94837935	missense	probably damaging	1.00
R0617:Plxnc1	UTSW	10	94799368	missense	probably damaging	1.00
R0671:Plxnc1	UTSW	10	94799332	missense	possibly damaging	0.63
R0692:Plxnc1	UTSW	10	94837500	critical splice donor site	probably null
R0751:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1184:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1260:Plxnc1	UTSW	10	94831365	missense	probably damaging	0.99
R1746:Plxnc1	UTSW	10	94844179	splice site	probably null
R1750:Plxnc1	UTSW	10	94799497	missense	probably damaging	1.00
R1751:Plxnc1	UTSW	10	94849815	unclassified	probably benign
R1768:Plxnc1	UTSW	10	94844322	missense	probably benign	0.05
R1876:Plxnc1	UTSW	10	94866941	missense	possibly damaging	0.94
R2004:Plxnc1	UTSW	10	94852622	missense	probably damaging	0.98
R2031:Plxnc1	UTSW	10	94943667	missense	probably benign	0.26
R2184:Plxnc1	UTSW	10	94944269	missense	probably damaging	1.00
R2437:Plxnc1	UTSW	10	94906533	missense	probably benign	0.02
R2927:Plxnc1	UTSW	10	94793292	critical splice acceptor site	probably null
R3001:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3002:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3003:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3441:Plxnc1	UTSW	10	94871010	missense	probably benign	0.00
R3849:Plxnc1	UTSW	10	94794432	missense	probably benign	0.01
R3884:Plxnc1	UTSW	10	94910687	splice site	probably null
R4004:Plxnc1	UTSW	10	94794597	nonsense	probably null
R4679:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
R4730:Plxnc1	UTSW	10	94867468	intron	probably benign
R4937:Plxnc1	UTSW	10	94841473	missense	probably damaging	1.00
R5068:Plxnc1	UTSW	10	94799377	missense	possibly damaging	0.91
R5345:Plxnc1	UTSW	10	94849969	missense	probably benign	0.26
R5397:Plxnc1	UTSW	10	94843752	missense	probably benign	0.08
R5416:Plxnc1	UTSW	10	94837554	missense	probably damaging	1.00
R5485:Plxnc1	UTSW	10	94922742	missense	probably benign	0.00
R5543:Plxnc1	UTSW	10	94864774	missense	probably benign
R5826:Plxnc1	UTSW	10	94799473	critical splice donor site	probably null
R6007:Plxnc1	UTSW	10	94793290	missense	possibly damaging	0.88
R6018:Plxnc1	UTSW	10	94943848	missense	probably benign	0.21
R6052:Plxnc1	UTSW	10	94943773	missense	probably benign	0.13
R6291:Plxnc1	UTSW	10	94833642	splice site	probably null
R6653:Plxnc1	UTSW	10	94943876	missense	probably damaging	1.00
R6984:Plxnc1	UTSW	10	94831530	missense	probably damaging	1.00
R7086:Plxnc1	UTSW	10	94831435	missense	probably benign
R7401:Plxnc1	UTSW	10	94871005	missense	probably benign
R7727:Plxnc1	UTSW	10	94944109	missense	probably damaging	1.00
R7789:Plxnc1	UTSW	10	94794477	missense	probably damaging	1.00
R7803:Plxnc1	UTSW	10	94943515	critical splice donor site	probably null
R7809:Plxnc1	UTSW	10	94794440	missense	probably damaging	1.00
R7882:Plxnc1	UTSW	10	94843836	missense	probably benign
R8103:Plxnc1	UTSW	10	94871082	missense	probably benign
R8226:Plxnc1	UTSW	10	94833368	missense	possibly damaging	0.90
R8273:Plxnc1	UTSW	10	94813243	missense	probably benign	0.14
R8299:Plxnc1	UTSW	10	94827179	missense	probably benign	0.35
R8392:Plxnc1	UTSW	10	94801490	missense	possibly damaging	0.75
R8758:Plxnc1	UTSW	10	94922745	missense	possibly damaging	0.91
R8806:Plxnc1	UTSW	10	94799278	missense	probably damaging	1.00
R8882:Plxnc1	UTSW	10	94841566	missense	probably damaging	1.00
R8893:Plxnc1	UTSW	10	94849847	missense	probably benign	0.35
R8956:Plxnc1	UTSW	10	94910586	missense	probably benign	0.00
R9040:Plxnc1	UTSW	10	94943517	nonsense	probably null
R9102:Plxnc1	UTSW	10	94827245	missense	probably damaging	1.00
R9225:Plxnc1	UTSW	10	94793199	missense	probably damaging	1.00
R9324:Plxnc1	UTSW	10	94944823	start gained	probably benign
R9368:Plxnc1	UTSW	10	94864737	nonsense	probably null
R9375:Plxnc1	UTSW	10	94813231	missense	probably benign	0.20
R9430:Plxnc1	UTSW	10	94922682	missense	probably benign	0.01
RF003:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
RF045:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF046:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF047:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
X0024:Plxnc1	UTSW	10	94864715	critical splice donor site	probably null
Z1176:Plxnc1	UTSW	10	94865029	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CAAAAGCTGAAGGTCTACCTGCCC -3'
(R):5'- CCTTCCTGACTGGAAGCATCAGTG -3'

Sequencing Primer
(F):5'- TACCTGCCCACGGAGAAG -3'
(R):5'- ACCGCTGCACTAGTAAGGTTC -3'

Posted On

2014-05-09