Incidental Mutation 'R1680:Patz1'
ID188434
Institutional Source Beutler Lab
Gene Symbol Patz1
Ensembl Gene ENSMUSG00000020453
Gene NamePOZ (BTB) and AT hook containing zinc finger 1
SynonymsMAZR, POZ-AT hook-zinc finger protein, 8430401L15Rik, Zfp278
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3288874-3309083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3307812 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 604 (K604E)
Ref Sequence ENSEMBL: ENSMUSP00000105670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057089
AA Change: K558E

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453
AA Change: K558E

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 559 582 1.98e-4 SMART
low complexity region 585 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093402
SMART Domains Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101644
Predicted Effect probably damaging
Transcript: ENSMUST00000110043
AA Change: K604E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: K604E

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 495 517 1.26e-2 SMART
Pfam:zf-C2H2_assoc3 536 604 6.5e-36 PFAM
ZnF_C2H2 605 628 1.98e-4 SMART
low complexity region 631 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123983
Predicted Effect probably benign
Transcript: ENSMUST00000134089
SMART Domains Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 5 29 2.82e0 SMART
ZnF_C2H2 33 54 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152576
Predicted Effect probably benign
Transcript: ENSMUST00000154319
SMART Domains Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 6 25 5.68e1 SMART
ZnF_C2H2 29 50 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155332
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Patz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Patz1 APN 11 3291134 missense probably damaging 1.00
IGL02954:Patz1 APN 11 3291761 missense probably damaging 1.00
IGL02981:Patz1 APN 11 3290656 missense probably damaging 1.00
R0153:Patz1 UTSW 11 3293288 missense probably damaging 1.00
R0758:Patz1 UTSW 11 3290879 missense probably damaging 1.00
R1954:Patz1 UTSW 11 3291088 missense probably damaging 0.99
R4610:Patz1 UTSW 11 3306241 missense probably damaging 1.00
R4964:Patz1 UTSW 11 3307720 missense probably damaging 1.00
R5832:Patz1 UTSW 11 3306277 missense probably benign 0.00
R7172:Patz1 UTSW 11 3308032 missense probably benign
R7454:Patz1 UTSW 11 3298297 start gained probably benign
R8026:Patz1 UTSW 11 3307658 missense not run
R8047:Patz1 UTSW 11 3306283 missense not run
Z1177:Patz1 UTSW 11 3291751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCATAGAAGGCCAGAAATGCTCAC -3'
(R):5'- TCACAGCATTGCTCAGCAGTCC -3'

Sequencing Primer
(F):5'- TCACATCAGGATCTGATTGAGAGC -3'
(R):5'- TGATGCAAACGCTGACTGAAC -3'
Posted On2014-05-09