Incidental Mutation 'R1680:Dnmt3a'
ID188443
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene NameDNA methyltransferase 3A
Synonyms
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3806007-3914443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3873361 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 187 (Q187R)
Ref Sequence ENSEMBL: ENSMUSP00000133501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000172509] [ENSMUST00000172719] [ENSMUST00000174483] [ENSMUST00000174817]
Predicted Effect probably benign
Transcript: ENSMUST00000020991
AA Change: Q187R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661
AA Change: Q187R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172509
AA Change: Q113R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133869
Gene: ENSMUSG00000020661
AA Change: Q113R

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
PWWP 212 270 1.36e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172719
AA Change: Q187R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133501
Gene: ENSMUSG00000020661
AA Change: Q187R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173197
AA Change: Q62R
SMART Domains Protein: ENSMUSP00000133567
Gene: ENSMUSG00000020661
AA Change: Q62R

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174817
AA Change: Q187R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661
AA Change: Q187R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3905622 missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3872886 splice site probably benign
IGL02815:Dnmt3a APN 12 3904226 critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3902666 missense probably damaging 1.00
R0028:Dnmt3a UTSW 12 3900337 missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R0843:Dnmt3a UTSW 12 3872886 splice site probably benign
R1055:Dnmt3a UTSW 12 3872864 missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3901660 missense probably damaging 0.99
R1753:Dnmt3a UTSW 12 3873342 missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3872859 missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3849654 utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3897551 splice site probably null
R2359:Dnmt3a UTSW 12 3901599 missense probably damaging 1.00
R2384:Dnmt3a UTSW 12 3901591 missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3899883 missense probably damaging 1.00
R2884:Dnmt3a UTSW 12 3896132 missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3849626 splice site probably null
R4281:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4809:Dnmt3a UTSW 12 3900352 missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3896008 missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3895643 missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3899615 missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3885660 splice site probably null
R5928:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3902399 missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3907623 missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3897406 missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3897600 missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3897591 missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3872844 missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3902397 missense probably damaging 1.00
R7239:Dnmt3a UTSW 12 3872850 missense probably benign 0.01
R7490:Dnmt3a UTSW 12 3904204 missense probably damaging 1.00
R7588:Dnmt3a UTSW 12 3896080 missense possibly damaging 0.91
R7684:Dnmt3a UTSW 12 3897340 missense probably benign 0.02
R8058:Dnmt3a UTSW 12 3902768 missense possibly damaging 0.92
Z1176:Dnmt3a UTSW 12 3904201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCCTCCAGGAGGAATGAACC -3'
(R):5'- TGTTACCTCTTCCAAGAGACCCGC -3'

Sequencing Primer
(F):5'- ACCTGTGCCCACCTTAATAC -3'
(R):5'- CTAGTAGCAGTTCCTGGAAGCAC -3'
Posted On2014-05-09