Incidental Mutation 'R1680:Fam160b2'
ID188447
Institutional Source Beutler Lab
Gene Symbol Fam160b2
Ensembl Gene ENSMUSG00000022095
Gene Namefamily with sequence similarity 160, member B2
SynonymsRai16, G430067P06Rik
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1680 (G1)
Quality Score207
Status Not validated
Chromosome14
Chromosomal Location70583296-70599835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70586851 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 482 (Y482C)
Ref Sequence ENSEMBL: ENSMUSP00000022690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554]
Predicted Effect probably damaging
Transcript: ENSMUST00000022690
AA Change: Y482C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095
AA Change: Y482C

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089049
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228554
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Fam160b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Fam160b2 APN 14 70585373 missense probably damaging 1.00
IGL01862:Fam160b2 APN 14 70587690 missense probably benign 0.03
IGL02306:Fam160b2 APN 14 70588997 missense probably benign
IGL02534:Fam160b2 APN 14 70585688 missense probably damaging 0.98
IGL02534:Fam160b2 APN 14 70586190 missense probably benign
IGL03071:Fam160b2 APN 14 70586209 missense probably damaging 1.00
IGL03162:Fam160b2 APN 14 70587554 missense probably damaging 1.00
IGL03166:Fam160b2 APN 14 70590176 missense probably damaging 1.00
IGL03134:Fam160b2 UTSW 14 70588709 missense possibly damaging 0.66
R0043:Fam160b2 UTSW 14 70588661 missense probably benign 0.45
R0628:Fam160b2 UTSW 14 70587721 missense possibly damaging 0.48
R0691:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R1727:Fam160b2 UTSW 14 70593998 missense probably damaging 0.98
R2059:Fam160b2 UTSW 14 70585049 missense possibly damaging 0.54
R2362:Fam160b2 UTSW 14 70586365 missense probably benign 0.18
R3423:Fam160b2 UTSW 14 70586585 missense probably damaging 1.00
R4233:Fam160b2 UTSW 14 70586878 missense probably damaging 0.99
R4770:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R5903:Fam160b2 UTSW 14 70591681 missense probably damaging 1.00
R6217:Fam160b2 UTSW 14 70591758 splice site probably null
R6665:Fam160b2 UTSW 14 70585638 missense probably damaging 1.00
R7424:Fam160b2 UTSW 14 70594007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTTGCCATCCGAACTGG -3'
(R):5'- AAGGGAAGTGACCCCACCTTAGAG -3'

Sequencing Primer
(F):5'- CATCCGAACTGGTGGCG -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-05-09