Incidental Mutation 'R1680:Col22a1'
ID188449
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71799361 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1050 (A1050V)
Ref Sequence ENSEMBL: ENSMUSP00000155641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000229585]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158270
Predicted Effect unknown
Transcript: ENSMUST00000159993
AA Change: A1605V
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: A1605V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: A1050V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230974
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120
Predicted Primers PCR Primer
(F):5'- ACATGGTCAGGGTTGCATAGCAC -3'
(R):5'- ACAGCACAGATTACAGGGCTGTTTC -3'

Sequencing Primer
(F):5'- aggcaggcaaggagaaaag -3'
(R):5'- AGATTACAGGGCTGTTTCTCTCC -3'
Posted On2014-05-09