Incidental Mutation 'R1680:Mapk8ip3'
ID188453
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Namemitogen-activated protein kinase 8 interacting protein 3
SynonymsJSAP1, Syd2, JNK-interacting protein 3, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, D17Wsu15e, Jip3, JSAP1a, JSAP1b, JSAP1c, sunday driver 2, JSAP1d, JUN/SAPK-associated protein 1
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24892153-24936977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24901011 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 983 (V983A)
Ref Sequence ENSEMBL: ENSMUSP00000114802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000120035] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000146923] [ENSMUST00000154236] [ENSMUST00000178969]
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088345
AA Change: V983A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: V983A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
AA Change: V968A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: V968A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115229
AA Change: V991A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: V991A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117509
AA Change: V960A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: V960A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119115
AA Change: V951A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: V951A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120035
AA Change: V982A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: V982A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121723
AA Change: V952A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: V952A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121787
AA Change: V946A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: V946A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect probably damaging
Transcript: ENSMUST00000146923
AA Change: V983A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: V983A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152486
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect probably damaging
Transcript: ENSMUST00000178969
AA Change: V983A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: V983A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 24900819 missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 24899719 splice site probably benign
IGL01066:Mapk8ip3 APN 17 24901718 missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 24918029 missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 24927861 missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 24903280 splice site probably benign
IGL02219:Mapk8ip3 APN 17 24899558 missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 24901515 missense probably benign
ANU74:Mapk8ip3 UTSW 17 24900577 missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 24902119 intron probably null
R0028:Mapk8ip3 UTSW 17 24904897 splice site probably benign
R0401:Mapk8ip3 UTSW 17 24909171 intron probably benign
R0496:Mapk8ip3 UTSW 17 24914450 splice site probably benign
R1456:Mapk8ip3 UTSW 17 24906949 missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 24904923 missense probably damaging 1.00
R1554:Mapk8ip3 UTSW 17 24903059 missense probably benign 0.14
R1733:Mapk8ip3 UTSW 17 24936850 missense possibly damaging 0.70
R1741:Mapk8ip3 UTSW 17 24899854 missense probably damaging 1.00
R1750:Mapk8ip3 UTSW 17 24914459 missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 24924145 critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 24914583 missense probably benign 0.29
R1911:Mapk8ip3 UTSW 17 24904051 missense probably benign 0.00
R1993:Mapk8ip3 UTSW 17 24914588 missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 24914703 nonsense probably null
R2656:Mapk8ip3 UTSW 17 24912807 missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 24905292 missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 24903293 missense probably benign
R4649:Mapk8ip3 UTSW 17 24904752 missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 24901415 missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 24901209 missense probably benign
R4915:Mapk8ip3 UTSW 17 24909153 missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 24899189 missense probably benign
R5642:Mapk8ip3 UTSW 17 24903311 missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 24906905 missense probably damaging 0.99
R6900:Mapk8ip3 UTSW 17 24909123 intron probably null
R7178:Mapk8ip3 UTSW 17 24901754 missense probably benign 0.02
R7273:Mapk8ip3 UTSW 17 24906174 missense probably benign 0.00
R7317:Mapk8ip3 UTSW 17 24901718 missense probably benign 0.00
R7323:Mapk8ip3 UTSW 17 24901161 missense probably benign
R7701:Mapk8ip3 UTSW 17 24901404 missense possibly damaging 0.93
R7873:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R7956:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R8070:Mapk8ip3 UTSW 17 24901104 critical splice donor site probably null
X0024:Mapk8ip3 UTSW 17 24903973 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCTCCACGATGGAAGATAGCCAGG -3'
(R):5'- AATGGGTCAGAGTCCAATGGCAC -3'

Sequencing Primer
(F):5'- GGTCCCATCTGCAAGAGCTAC -3'
(R):5'- TGTACAGCCTCAGGTGGAG -3'
Posted On2014-05-09