Incidental Mutation 'R1680:Zbtb14'
ID188456
Institutional Source Beutler Lab
Gene Symbol Zbtb14
Ensembl Gene ENSMUSG00000049672
Gene Namezinc finger and BTB domain containing 14
SynonymsZfp161, b2b1982Clo, ZF5
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location69383050-69390750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69388502 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 398 (F398L)
Ref Sequence ENSEMBL: ENSMUSP00000108296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]
Predicted Effect probably damaging
Transcript: ENSMUST00000062369
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112674
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112676
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Zbtb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL01623:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL02477:Zbtb14 APN 17 69387695 missense probably benign 0.00
PIT4687001:Zbtb14 UTSW 17 69388307 nonsense probably null
R0736:Zbtb14 UTSW 17 69387802 missense possibly damaging 0.66
R0811:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0812:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0829:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0866:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0946:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0947:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1052:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1053:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1056:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1076:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1187:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1374:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1471:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1505:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1507:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1508:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1509:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1514:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1691:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1712:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1907:Zbtb14 UTSW 17 69387390 missense possibly damaging 0.91
R1981:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R2916:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R2918:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R4589:Zbtb14 UTSW 17 69388470 missense probably damaging 1.00
R4622:Zbtb14 UTSW 17 69388347 missense possibly damaging 0.80
R4812:Zbtb14 UTSW 17 69387582 missense probably damaging 1.00
R6246:Zbtb14 UTSW 17 69387483 missense possibly damaging 0.46
R6889:Zbtb14 UTSW 17 69387679 missense probably damaging 1.00
R7575:Zbtb14 UTSW 17 69387447 missense probably damaging 0.98
R7716:Zbtb14 UTSW 17 69387420 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGAGGTGTGCGGAAAGTCATTC -3'
(R):5'- GCCACAAAGCGGTCAAAGGTGTTC -3'

Sequencing Primer
(F):5'- CGGAAAGTCATTCATCCGC -3'
(R):5'- AGGTGTTCACTGACTACAGC -3'
Posted On2014-05-09