Incidental Mutation 'R1680:Zbtb14'
ID 188456
Institutional Source Beutler Lab
Gene Symbol Zbtb14
Ensembl Gene ENSMUSG00000049672
Gene Name zinc finger and BTB domain containing 14
Synonyms Zfp161, b2b1982Clo, ZF5
MMRRC Submission 039716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.881) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 69690170-69697747 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 69695497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 398 (F398L)
Ref Sequence ENSEMBL: ENSMUSP00000108296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]
AlphaFold Q08376
Predicted Effect probably damaging
Transcript: ENSMUST00000062369
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112674
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112676
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,439,390 (GRCm39) P187R probably damaging Het
Ahnak T A 19: 8,987,327 (GRCm39) H2870Q probably benign Het
Arhgef33 C T 17: 80,655,080 (GRCm39) S95F probably damaging Het
Atp1a2 T A 1: 172,106,521 (GRCm39) D827V probably damaging Het
Bcat1 T G 6: 144,985,354 (GRCm39) D96A probably damaging Het
Birc6 A T 17: 74,855,741 (GRCm39) I184L probably benign Het
Clca3b A T 3: 144,543,585 (GRCm39) L415M probably damaging Het
Clstn1 T C 4: 149,728,183 (GRCm39) V617A probably benign Het
Col22a1 G A 15: 71,671,210 (GRCm39) A1050V unknown Het
Col5a3 C T 9: 20,695,964 (GRCm39) probably null Het
Csmd3 G A 15: 47,604,566 (GRCm39) T1059I probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnm3 A G 1: 161,838,545 (GRCm39) V272A probably benign Het
Dnmt3a A G 12: 3,923,361 (GRCm39) Q187R probably damaging Het
Dpp9 A G 17: 56,497,103 (GRCm39) Y710H probably benign Het
Eef1a2 A T 2: 180,794,734 (GRCm39) M155K possibly damaging Het
Entpd8 G A 2: 24,974,036 (GRCm39) C331Y probably damaging Het
Erc1 A C 6: 119,552,722 (GRCm39) L1072R probably damaging Het
Fhip2b T C 14: 70,824,291 (GRCm39) Y482C probably damaging Het
Gtf3c2 A G 5: 31,331,212 (GRCm39) S155P probably damaging Het
Gucy2c A G 6: 136,699,491 (GRCm39) S617P probably damaging Het
Ice1 T C 13: 70,753,567 (GRCm39) R840G probably benign Het
Il1rl2 T C 1: 40,390,953 (GRCm39) Y299H possibly damaging Het
Ints7 T G 1: 191,353,274 (GRCm39) probably null Het
Ireb2 C T 9: 54,788,802 (GRCm39) T92I probably damaging Het
Itprid1 C T 6: 55,945,751 (GRCm39) T824I probably damaging Het
Kcnj8 A T 6: 142,515,915 (GRCm39) L64* probably null Het
Mapk8ip3 A G 17: 25,119,985 (GRCm39) V983A probably damaging Het
Mertk A G 2: 128,643,556 (GRCm39) D985G probably benign Het
Mical3 A T 6: 120,936,604 (GRCm39) S1307R probably benign Het
Mtcl3 A T 10: 29,072,835 (GRCm39) Q709L probably damaging Het
Ncaph2 A G 15: 89,248,825 (GRCm39) D222G probably benign Het
Nf1 C A 11: 79,441,824 (GRCm39) S295* probably null Het
Nlrp12 T A 7: 3,289,804 (GRCm39) D236V probably damaging Het
Npnt A G 3: 132,612,563 (GRCm39) V74A probably benign Het
Oasl1 A G 5: 115,074,003 (GRCm39) D304G probably damaging Het
Or52i2 A G 7: 102,319,940 (GRCm39) D271G possibly damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Or8g22 T C 9: 38,958,296 (GRCm39) I140V probably benign Het
Or8h8 C T 2: 86,753,505 (GRCm39) V124I probably benign Het
Patz1 A G 11: 3,257,812 (GRCm39) K604E probably damaging Het
Pcsk6 T A 7: 65,684,998 (GRCm39) V793E probably benign Het
Pla2g4d C T 2: 120,108,231 (GRCm39) probably null Het
Plxnc1 A C 10: 94,677,413 (GRCm39) L938R probably benign Het
Pou4f2 G T 8: 79,161,460 (GRCm39) A381D probably damaging Het
Prdm4 A G 10: 85,735,087 (GRCm39) L685P possibly damaging Het
Pxn T A 5: 115,690,206 (GRCm39) V383E probably damaging Het
Rbl1 A G 2: 157,016,703 (GRCm39) L632P probably damaging Het
Rnf135 T A 11: 80,087,707 (GRCm39) S219T possibly damaging Het
Sdk2 T C 11: 113,682,262 (GRCm39) D2039G possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slc5a6 A G 5: 31,199,988 (GRCm39) Y131H probably damaging Het
Slc9a1 T C 4: 133,145,391 (GRCm39) I492T probably damaging Het
Spag5 A G 11: 78,211,442 (GRCm39) K993E probably damaging Het
Sptbn1 T G 11: 30,109,371 (GRCm39) I75L possibly damaging Het
Syngap1 T C 17: 27,171,553 (GRCm39) S46P possibly damaging Het
Tfcp2l1 T A 1: 118,603,335 (GRCm39) F458I probably damaging Het
Tmem67 A G 4: 12,087,840 (GRCm39) V102A probably benign Het
Tomm70a T C 16: 56,942,324 (GRCm39) S34P unknown Het
Txlnb G T 10: 17,718,981 (GRCm39) G604V probably benign Het
Ube2q1 A G 3: 89,683,483 (GRCm39) T143A probably benign Het
Unc80 C T 1: 66,542,828 (GRCm39) R361* probably null Het
Vcan T C 13: 89,851,666 (GRCm39) D1098G probably benign Het
Vmn1r176 T A 7: 23,534,806 (GRCm39) T116S probably damaging Het
Wdr81 C T 11: 75,345,249 (GRCm39) R6K probably benign Het
Zan T A 5: 137,401,312 (GRCm39) T4136S unknown Het
Zfp606 A T 7: 12,227,898 (GRCm39) H615L probably damaging Het
Zp3r A T 1: 130,510,617 (GRCm39) N433K probably benign Het
Other mutations in Zbtb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Zbtb14 APN 17 69,695,184 (GRCm39) missense probably benign 0.04
IGL01623:Zbtb14 APN 17 69,695,184 (GRCm39) missense probably benign 0.04
IGL02477:Zbtb14 APN 17 69,694,690 (GRCm39) missense probably benign 0.00
PIT4687001:Zbtb14 UTSW 17 69,695,302 (GRCm39) nonsense probably null
R0736:Zbtb14 UTSW 17 69,694,797 (GRCm39) missense possibly damaging 0.66
R0811:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R0812:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R0829:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R0866:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R0946:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R0947:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1052:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1053:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1056:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1076:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1187:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1374:Zbtb14 UTSW 17 69,694,575 (GRCm39) missense probably damaging 1.00
R1471:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1505:Zbtb14 UTSW 17 69,694,759 (GRCm39) missense probably benign 0.00
R1507:Zbtb14 UTSW 17 69,694,759 (GRCm39) missense probably benign 0.00
R1508:Zbtb14 UTSW 17 69,694,759 (GRCm39) missense probably benign 0.00
R1509:Zbtb14 UTSW 17 69,694,759 (GRCm39) missense probably benign 0.00
R1514:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1691:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R1712:Zbtb14 UTSW 17 69,694,575 (GRCm39) missense probably damaging 1.00
R1907:Zbtb14 UTSW 17 69,694,385 (GRCm39) missense possibly damaging 0.91
R1981:Zbtb14 UTSW 17 69,695,497 (GRCm39) missense probably damaging 1.00
R2916:Zbtb14 UTSW 17 69,695,214 (GRCm39) missense probably damaging 1.00
R2918:Zbtb14 UTSW 17 69,695,214 (GRCm39) missense probably damaging 1.00
R4589:Zbtb14 UTSW 17 69,695,465 (GRCm39) missense probably damaging 1.00
R4622:Zbtb14 UTSW 17 69,695,342 (GRCm39) missense possibly damaging 0.80
R4812:Zbtb14 UTSW 17 69,694,577 (GRCm39) missense probably damaging 1.00
R6246:Zbtb14 UTSW 17 69,694,478 (GRCm39) missense possibly damaging 0.46
R6889:Zbtb14 UTSW 17 69,694,674 (GRCm39) missense probably damaging 1.00
R7575:Zbtb14 UTSW 17 69,694,442 (GRCm39) missense probably damaging 0.98
R7716:Zbtb14 UTSW 17 69,694,415 (GRCm39) missense probably benign
R8976:Zbtb14 UTSW 17 69,694,752 (GRCm39) missense possibly damaging 0.95
R9341:Zbtb14 UTSW 17 69,695,576 (GRCm39) missense probably damaging 0.97
R9343:Zbtb14 UTSW 17 69,695,576 (GRCm39) missense probably damaging 0.97
R9638:Zbtb14 UTSW 17 69,695,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAGGTGTGCGGAAAGTCATTC -3'
(R):5'- GCCACAAAGCGGTCAAAGGTGTTC -3'

Sequencing Primer
(F):5'- CGGAAAGTCATTCATCCGC -3'
(R):5'- AGGTGTTCACTGACTACAGC -3'
Posted On 2014-05-09