Incidental Mutation 'R1681:Lonrf2'
ID 188460
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene Name LON peptidase N-terminal domain and ring finger 2
Synonyms 2900060P06Rik
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 38793645-38836711 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38813276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 165 (P165S)
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
AlphaFold F6ZE64
Predicted Effect probably benign
Transcript: ENSMUST00000039612
AA Change: P165S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814
AA Change: P165S

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147695
AA Change: P165S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814
AA Change: P165S

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38812535 splice site probably benign
IGL02369:Lonrf2 APN 1 38811832 splice site probably benign
IGL02526:Lonrf2 APN 1 38800710 missense probably benign 0.02
gorged UTSW 1 38804336 missense probably benign 0.05
Swollen UTSW 1 38813389 missense probably benign
R1450:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1527:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38811824 missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2044:Lonrf2 UTSW 1 38807050 missense probably benign 0.17
R2054:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2656:Lonrf2 UTSW 1 38815960 splice site probably null
R4084:Lonrf2 UTSW 1 38821151 missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38818059 splice site probably null
R4796:Lonrf2 UTSW 1 38816038 missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38807153 missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38807047 missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38807093 missense probably benign 0.17
R6441:Lonrf2 UTSW 1 38818123 missense possibly damaging 0.76
R6533:Lonrf2 UTSW 1 38813268 missense probably benign 0.08
R6695:Lonrf2 UTSW 1 38813389 missense probably benign
R6930:Lonrf2 UTSW 1 38804336 missense probably benign 0.05
R7923:Lonrf2 UTSW 1 38800762 missense probably benign 0.30
R8237:Lonrf2 UTSW 1 38800773 missense probably benign 0.00
R9072:Lonrf2 UTSW 1 38811786 missense probably damaging 1.00
R9073:Lonrf2 UTSW 1 38811786 missense probably damaging 1.00
R9433:Lonrf2 UTSW 1 38836457 start gained probably benign
R9468:Lonrf2 UTSW 1 38800758 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTAGAAAAGAAGCCGGTCTCCTC -3'
(R):5'- GAAGGCTAACGCATGGTTTAGTTTGC -3'

Sequencing Primer
(F):5'- AAAGAAGCCGGTCTCCTCATTTC -3'
(R):5'- ggtttagtttgctttggtttgg -3'
Posted On 2014-05-09