Incidental Mutation 'R1681:Tlr4'
ID 188482
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Name toll-like receptor 4
Synonyms Lps, lipopolysaccharide response, Rasl2-8
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 66745788-66765338 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66759342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 712 (P712S)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
AlphaFold Q9QUK6
PDB Structure Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048096
AA Change: P712S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: P712S

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66,758,662 (GRCm39) missense probably benign 0.01
IGL01343:Tlr4 APN 4 66,752,124 (GRCm39) splice site probably benign
IGL01669:Tlr4 APN 4 66,759,504 (GRCm39) missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66,757,726 (GRCm39) missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66,759,202 (GRCm39) missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66,752,298 (GRCm39) critical splice donor site probably null
IGL02793:Tlr4 APN 4 66,757,681 (GRCm39) missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66,759,033 (GRCm39) missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66,757,990 (GRCm39) missense probably damaging 0.99
bugsy UTSW 4 66,757,491 (GRCm39) nonsense probably null
Cruyff UTSW 4 66,758,563 (GRCm39) missense probably damaging 1.00
don_knotts UTSW 4 66,759,409 (GRCm39) missense probably damaging 1.00
Guardiola UTSW 4 66,757,540 (GRCm39) missense probably damaging 1.00
Lops UTSW 4 66,752,117 (GRCm39) splice site probably null
lps3 UTSW 4 66,759,334 (GRCm39) missense probably damaging 1.00
Lps4 UTSW 4 66,759,379 (GRCm39) missense probably damaging 1.00
milquetoast UTSW 4 66,757,681 (GRCm39) missense probably damaging 1.00
salvador UTSW 4 66,758,443 (GRCm39) missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66,757,857 (GRCm39) missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66,746,153 (GRCm39) missense probably benign 0.05
R0576:Tlr4 UTSW 4 66,757,732 (GRCm39) missense probably benign 0.00
R0827:Tlr4 UTSW 4 66,752,117 (GRCm39) splice site probably null
R1488:Tlr4 UTSW 4 66,757,786 (GRCm39) missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66,757,611 (GRCm39) missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66,757,933 (GRCm39) missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66,757,717 (GRCm39) missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66,759,313 (GRCm39) missense probably benign 0.19
R1888:Tlr4 UTSW 4 66,759,409 (GRCm39) missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66,759,409 (GRCm39) missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66,757,681 (GRCm39) missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66,759,272 (GRCm39) missense probably benign 0.40
R1998:Tlr4 UTSW 4 66,758,707 (GRCm39) missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66,758,220 (GRCm39) missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66,758,338 (GRCm39) missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66,757,491 (GRCm39) nonsense probably null
R3420:Tlr4 UTSW 4 66,757,773 (GRCm39) missense probably benign 0.37
R3422:Tlr4 UTSW 4 66,757,773 (GRCm39) missense probably benign 0.37
R3818:Tlr4 UTSW 4 66,759,553 (GRCm39) missense probably benign 0.00
R4212:Tlr4 UTSW 4 66,758,563 (GRCm39) missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66,758,563 (GRCm39) missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66,757,540 (GRCm39) missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66,757,477 (GRCm39) missense probably benign 0.44
R4735:Tlr4 UTSW 4 66,759,435 (GRCm39) missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66,759,616 (GRCm39) missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66,759,122 (GRCm39) missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66,752,217 (GRCm39) missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66,758,652 (GRCm39) missense probably benign
R6021:Tlr4 UTSW 4 66,759,103 (GRCm39) missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66,758,070 (GRCm39) missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66,758,832 (GRCm39) missense probably benign
R7139:Tlr4 UTSW 4 66,758,520 (GRCm39) missense probably benign 0.06
R7199:Tlr4 UTSW 4 66,759,430 (GRCm39) missense probably damaging 0.99
R7220:Tlr4 UTSW 4 66,758,188 (GRCm39) missense probably benign
R7337:Tlr4 UTSW 4 66,758,191 (GRCm39) missense possibly damaging 0.86
R7487:Tlr4 UTSW 4 66,842,659 (GRCm39) missense probably benign 0.00
R7638:Tlr4 UTSW 4 66,758,443 (GRCm39) missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66,757,836 (GRCm39) missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66,759,316 (GRCm39) missense probably damaging 1.00
R7897:Tlr4 UTSW 4 66,758,058 (GRCm39) missense probably benign 0.07
R8044:Tlr4 UTSW 4 66,746,084 (GRCm39) missense probably benign 0.01
R8062:Tlr4 UTSW 4 66,758,087 (GRCm39) missense probably benign 0.00
R8080:Tlr4 UTSW 4 66,757,713 (GRCm39) missense probably damaging 1.00
R8446:Tlr4 UTSW 4 66,757,673 (GRCm39) missense probably damaging 0.98
R8916:Tlr4 UTSW 4 66,847,268 (GRCm39) missense probably benign 0.06
R9100:Tlr4 UTSW 4 66,758,518 (GRCm39) missense probably benign 0.08
R9415:Tlr4 UTSW 4 66,746,160 (GRCm39) critical splice donor site probably null
R9562:Tlr4 UTSW 4 66,759,522 (GRCm39) missense possibly damaging 0.80
R9565:Tlr4 UTSW 4 66,759,522 (GRCm39) missense possibly damaging 0.80
R9752:Tlr4 UTSW 4 66,757,912 (GRCm39) missense probably benign 0.02
X0064:Tlr4 UTSW 4 66,758,377 (GRCm39) missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66,847,319 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTGTGATTGTGGTATCCACTGTAGC -3'
(R):5'- AGGGACTTCTCAACCTTCTCAAGGAC -3'

Sequencing Primer
(F):5'- GTGGTATCCACTGTAGCATTTC -3'
(R):5'- CCTTCTCAAGGACAATGAAGATG -3'
Posted On 2014-05-09