Incidental Mutation 'R1681:Lnx1'
ID 188491
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Name ligand of numb-protein X 1
Synonyms
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 74753108-74863573 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74846071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 126 (H126Q)
Ref Sequence ENSEMBL: ENSMUSP00000113035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087161] [ENSMUST00000117388]
AlphaFold O70263
Predicted Effect probably benign
Transcript: ENSMUST00000087161
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: H126Q

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117388
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: H126Q

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74,846,378 (GRCm39) missense probably benign 0.00
IGL01538:Lnx1 APN 5 74,780,816 (GRCm39) missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74,846,420 (GRCm39) missense probably benign 0.02
IGL03188:Lnx1 APN 5 74,780,924 (GRCm39) missense probably damaging 1.00
bobcat UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
Caracal UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74,781,008 (GRCm39) critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74,768,570 (GRCm39) splice site probably benign
R1343:Lnx1 UTSW 5 74,758,040 (GRCm39) missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74,780,678 (GRCm39) missense probably damaging 1.00
R1714:Lnx1 UTSW 5 74,768,398 (GRCm39) missense probably null 1.00
R1727:Lnx1 UTSW 5 74,768,577 (GRCm39) splice site probably null
R1806:Lnx1 UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74,780,727 (GRCm39) missense probably benign 0.25
R2879:Lnx1 UTSW 5 74,780,784 (GRCm39) missense probably benign 0.03
R2984:Lnx1 UTSW 5 74,846,083 (GRCm39) nonsense probably null
R3790:Lnx1 UTSW 5 74,789,027 (GRCm39) splice site probably benign
R3953:Lnx1 UTSW 5 74,766,750 (GRCm39) missense probably benign
R4509:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74,846,204 (GRCm39) missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4624:Lnx1 UTSW 5 74,821,121 (GRCm39) intron probably benign
R4647:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4648:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4877:Lnx1 UTSW 5 74,788,784 (GRCm39) missense probably benign 0.01
R4883:Lnx1 UTSW 5 74,768,530 (GRCm39) missense probably benign
R5256:Lnx1 UTSW 5 74,846,315 (GRCm39) missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74,838,230 (GRCm39) missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74,846,269 (GRCm39) nonsense probably null
R6408:Lnx1 UTSW 5 74,846,307 (GRCm39) missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74,768,541 (GRCm39) missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74,838,175 (GRCm39) nonsense probably null
R7511:Lnx1 UTSW 5 74,780,972 (GRCm39) missense probably benign 0.01
R7574:Lnx1 UTSW 5 74,846,099 (GRCm39) missense probably benign 0.33
R7670:Lnx1 UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
R8145:Lnx1 UTSW 5 74,846,060 (GRCm39) missense probably benign 0.22
R9015:Lnx1 UTSW 5 74,780,783 (GRCm39) missense probably benign 0.00
R9224:Lnx1 UTSW 5 74,766,810 (GRCm39) missense probably benign 0.37
R9321:Lnx1 UTSW 5 74,780,991 (GRCm39) missense probably damaging 1.00
R9340:Lnx1 UTSW 5 74,758,584 (GRCm39) missense probably benign 0.01
R9704:Lnx1 UTSW 5 74,780,879 (GRCm39) missense probably benign 0.02
Z1177:Lnx1 UTSW 5 74,788,102 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCACACAACCCAGTCCTACTTAGTG -3'
(R):5'- TTCTGCCCTGTGGATCGAAAGC -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- CGAAAGCCTGTGGTTCTGC -3'
Posted On 2014-05-09