Incidental Mutation 'R1681:Lnx1'
ID 188491
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Name ligand of numb-protein X 1
Synonyms
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 74592447-74702912 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74685410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 126 (H126Q)
Ref Sequence ENSEMBL: ENSMUSP00000113035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087161] [ENSMUST00000117388]
AlphaFold O70263
Predicted Effect probably benign
Transcript: ENSMUST00000087161
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: H126Q

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117388
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: H126Q

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74685717 missense probably benign 0.00
IGL01538:Lnx1 APN 5 74620155 missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74685759 missense probably benign 0.02
IGL03188:Lnx1 APN 5 74620263 missense probably damaging 1.00
bobcat UTSW 5 74685690 missense probably damaging 1.00
Caracal UTSW 5 74606049 missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74620347 critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74607909 splice site probably benign
R1343:Lnx1 UTSW 5 74597379 missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74620017 missense probably damaging 1.00
R1714:Lnx1 UTSW 5 74607737 missense probably null 1.00
R1727:Lnx1 UTSW 5 74607916 splice site probably null
R1806:Lnx1 UTSW 5 74606049 missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74620066 missense probably benign 0.25
R2879:Lnx1 UTSW 5 74620123 missense probably benign 0.03
R2984:Lnx1 UTSW 5 74685422 nonsense probably null
R3790:Lnx1 UTSW 5 74628366 splice site probably benign
R3953:Lnx1 UTSW 5 74606089 missense probably benign
R4509:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74685543 missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4624:Lnx1 UTSW 5 74660460 intron probably benign
R4647:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4648:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4877:Lnx1 UTSW 5 74628123 missense probably benign 0.01
R4883:Lnx1 UTSW 5 74607869 missense probably benign
R5256:Lnx1 UTSW 5 74685654 missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74677569 missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74685608 nonsense probably null
R6408:Lnx1 UTSW 5 74685646 missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74607880 missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74677514 nonsense probably null
R7511:Lnx1 UTSW 5 74620311 missense probably benign 0.01
R7574:Lnx1 UTSW 5 74685438 missense probably benign 0.33
R7670:Lnx1 UTSW 5 74685690 missense probably damaging 1.00
R8145:Lnx1 UTSW 5 74685399 missense probably benign 0.22
R9015:Lnx1 UTSW 5 74620122 missense probably benign 0.00
R9224:Lnx1 UTSW 5 74606149 missense probably benign 0.37
R9321:Lnx1 UTSW 5 74620330 missense probably damaging 1.00
R9340:Lnx1 UTSW 5 74597923 missense probably benign 0.01
R9704:Lnx1 UTSW 5 74620218 missense probably benign 0.02
Z1177:Lnx1 UTSW 5 74627441 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCACACAACCCAGTCCTACTTAGTG -3'
(R):5'- TTCTGCCCTGTGGATCGAAAGC -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- CGAAAGCCTGTGGTTCTGC -3'
Posted On 2014-05-09