Incidental Mutation 'R1681:Cntn3'
ID 188498
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Name contactin 3
Synonyms Pang
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 102140265-102541575 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102147629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 909 (N909K)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
AlphaFold Q07409
Predicted Effect probably damaging
Transcript: ENSMUST00000032159
AA Change: N909K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: N909K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203619
AA Change: N909K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: N909K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102,397,223 (GRCm39) nonsense probably null
IGL00706:Cntn3 APN 6 102,180,910 (GRCm39) missense probably benign 0.11
IGL01071:Cntn3 APN 6 102,397,212 (GRCm39) critical splice donor site probably null
IGL01769:Cntn3 APN 6 102,185,145 (GRCm39) missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102,180,846 (GRCm39) missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102,176,321 (GRCm39) splice site probably benign
IGL02736:Cntn3 APN 6 102,180,900 (GRCm39) missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102,255,262 (GRCm39) missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102,145,894 (GRCm39) missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102,164,060 (GRCm39) missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102,186,235 (GRCm39) missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102,441,527 (GRCm39) missense probably benign 0.22
R0314:Cntn3 UTSW 6 102,397,342 (GRCm39) missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102,254,277 (GRCm39) missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102,180,927 (GRCm39) missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R0543:Cntn3 UTSW 6 102,246,051 (GRCm39) splice site probably benign
R0629:Cntn3 UTSW 6 102,180,937 (GRCm39) missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102,145,908 (GRCm39) missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102,145,908 (GRCm39) missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102,222,119 (GRCm39) missense probably benign 0.22
R1110:Cntn3 UTSW 6 102,222,119 (GRCm39) missense probably benign 0.22
R1144:Cntn3 UTSW 6 102,219,087 (GRCm39) missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102,441,526 (GRCm39) nonsense probably null
R1640:Cntn3 UTSW 6 102,218,974 (GRCm39) missense possibly damaging 0.82
R1770:Cntn3 UTSW 6 102,246,166 (GRCm39) missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102,250,772 (GRCm39) missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102,222,032 (GRCm39) missense probably benign 0.11
R1930:Cntn3 UTSW 6 102,219,014 (GRCm39) nonsense probably null
R2026:Cntn3 UTSW 6 102,397,388 (GRCm39) missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102,183,498 (GRCm39) missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102,180,889 (GRCm39) missense probably benign
R2351:Cntn3 UTSW 6 102,314,344 (GRCm39) missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102,185,038 (GRCm39) missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102,176,312 (GRCm39) missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102,441,508 (GRCm39) missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102,145,943 (GRCm39) missense probably benign 0.37
R4678:Cntn3 UTSW 6 102,180,981 (GRCm39) missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102,142,292 (GRCm39) missense probably benign 0.37
R4720:Cntn3 UTSW 6 102,218,983 (GRCm39) missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102,244,389 (GRCm39) missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102,145,986 (GRCm39) missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102,255,314 (GRCm39) missense probably benign 0.01
R5502:Cntn3 UTSW 6 102,242,295 (GRCm39) missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102,397,377 (GRCm39) missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102,219,094 (GRCm39) missense probably benign 0.00
R6193:Cntn3 UTSW 6 102,185,092 (GRCm39) missense probably benign 0.31
R6258:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R6260:Cntn3 UTSW 6 102,254,178 (GRCm39) critical splice donor site probably null
R6350:Cntn3 UTSW 6 102,147,579 (GRCm39) missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102,255,301 (GRCm39) missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102,255,365 (GRCm39) missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102,250,772 (GRCm39) missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102,142,362 (GRCm39) missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102,142,305 (GRCm39) missense probably benign
R7208:Cntn3 UTSW 6 102,255,383 (GRCm39) nonsense probably null
R7395:Cntn3 UTSW 6 102,314,355 (GRCm39) critical splice acceptor site probably null
R7447:Cntn3 UTSW 6 102,255,416 (GRCm39) nonsense probably null
R7571:Cntn3 UTSW 6 102,255,364 (GRCm39) missense probably damaging 1.00
R7586:Cntn3 UTSW 6 102,397,388 (GRCm39) missense probably damaging 1.00
R7614:Cntn3 UTSW 6 102,142,337 (GRCm39) missense probably benign 0.17
R7697:Cntn3 UTSW 6 102,185,128 (GRCm39) missense probably damaging 1.00
R7697:Cntn3 UTSW 6 102,185,127 (GRCm39) missense probably damaging 1.00
R7849:Cntn3 UTSW 6 102,242,392 (GRCm39) missense probably benign 0.00
R8011:Cntn3 UTSW 6 102,414,860 (GRCm39) missense possibly damaging 0.93
R8013:Cntn3 UTSW 6 102,176,278 (GRCm39) missense probably benign 0.00
R8377:Cntn3 UTSW 6 102,186,254 (GRCm39) missense probably benign 0.00
R8726:Cntn3 UTSW 6 102,146,014 (GRCm39) nonsense probably null
R8770:Cntn3 UTSW 6 102,254,277 (GRCm39) missense possibly damaging 0.67
R8827:Cntn3 UTSW 6 102,246,094 (GRCm39) missense probably benign 0.01
R8947:Cntn3 UTSW 6 102,414,864 (GRCm39) missense probably damaging 1.00
R8997:Cntn3 UTSW 6 102,181,023 (GRCm39) missense probably damaging 0.98
R9055:Cntn3 UTSW 6 102,244,398 (GRCm39) missense probably benign 0.38
R9061:Cntn3 UTSW 6 102,314,288 (GRCm39) missense probably damaging 1.00
R9758:Cntn3 UTSW 6 102,183,511 (GRCm39) missense probably damaging 1.00
R9762:Cntn3 UTSW 6 102,254,196 (GRCm39) missense probably damaging 1.00
Z1088:Cntn3 UTSW 6 102,397,255 (GRCm39) missense possibly damaging 0.74
Z1176:Cntn3 UTSW 6 102,414,892 (GRCm39) critical splice acceptor site probably null
Z1177:Cntn3 UTSW 6 102,314,292 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAAGGGCAATCCTTATGGCTGGTTTTA -3'
(R):5'- AAAGGGCCTCCTTGGTTTTGTCTC -3'

Sequencing Primer
(F):5'- CATCATGCTTGAGTTCCTTAGGAAG -3'
(R):5'- CCTTCCATCTCTGCACCATGAG -3'
Posted On 2014-05-09