Incidental Mutation 'R1681:Lrrc4b'
ID 188506
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Name leucine rich repeat containing 4B
Synonyms NGL-3, Lrig4, Ngl3
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 44091911-44112775 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44110601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 158 (Y158N)
Ref Sequence ENSEMBL: ENSMUSP00000123389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000156093] [ENSMUST00000152902]
AlphaFold P0C192
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058667
AA Change: Y158N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: Y158N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127790
AA Change: Y158N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085
AA Change: Y158N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156093
AA Change: Y158N

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085
AA Change: Y158N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44,111,739 (GRCm39) missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44,111,876 (GRCm39) missense probably benign 0.44
R1421:Lrrc4b UTSW 7 44,110,475 (GRCm39) missense probably benign 0.00
R1622:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1778:Lrrc4b UTSW 7 44,111,823 (GRCm39) missense probably benign
R1967:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1989:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R2427:Lrrc4b UTSW 7 44,111,976 (GRCm39) missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44,111,796 (GRCm39) splice site probably null
R5249:Lrrc4b UTSW 7 44,111,988 (GRCm39) missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44,110,787 (GRCm39) missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44,111,754 (GRCm39) missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44,110,722 (GRCm39) missense possibly damaging 0.62
R7003:Lrrc4b UTSW 7 44,094,580 (GRCm39) missense probably damaging 1.00
R7392:Lrrc4b UTSW 7 44,111,439 (GRCm39) missense probably damaging 1.00
R7544:Lrrc4b UTSW 7 44,111,975 (GRCm39) missense probably damaging 1.00
R7582:Lrrc4b UTSW 7 44,111,234 (GRCm39) missense probably benign 0.00
R7596:Lrrc4b UTSW 7 44,111,310 (GRCm39) missense probably damaging 1.00
R7830:Lrrc4b UTSW 7 44,111,231 (GRCm39) missense possibly damaging 0.76
R7836:Lrrc4b UTSW 7 44,094,316 (GRCm39) start gained probably benign
R8116:Lrrc4b UTSW 7 44,110,533 (GRCm39) missense probably damaging 1.00
R8147:Lrrc4b UTSW 7 44,111,829 (GRCm39) missense probably damaging 1.00
R8376:Lrrc4b UTSW 7 44,112,018 (GRCm39) missense probably benign 0.00
R9226:Lrrc4b UTSW 7 44,112,099 (GRCm39) missense possibly damaging 0.85
R9674:Lrrc4b UTSW 7 44,111,852 (GRCm39) missense probably damaging 1.00
Z1176:Lrrc4b UTSW 7 44,110,736 (GRCm39) frame shift probably null
Z1176:Lrrc4b UTSW 7 44,094,547 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,111,335 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,094,404 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,094,403 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,112,041 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTGATCGCAGAGTCGCGTTCAC -3'
(R):5'- TAGGTTGCACATGCCCAGGTTGAG -3'

Sequencing Primer
(F):5'- TCACCTGCTGTGAACTGGAG -3'
(R):5'- TGAGGTAGCGCAGGTTCAC -3'
Posted On 2014-05-09