Incidental Mutation 'R1681:Tll1'
ID188509
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
SynonymsTll-1
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1681 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64085551 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 353 (L353R)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066166
AA Change: L353R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: L353R

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209451
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 intron probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAACTTGACTGGCAGAGGGACG -3'
(R):5'- CAGTTTGGGGATATAGAGCCAGCAC -3'

Sequencing Primer
(F):5'- cccagggttcaatctccag -3'
(R):5'- GGATATAGAGCCAGCACTAGTTAC -3'
Posted On2014-05-09