Mutagenetix > Incidental Mutations

Incidental Mutation 'R1681:Chd9'

188513

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik

MMRRC Submission

039717-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1681 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90828352-91054516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90973135 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 598 (I598F)

Ref Sequence

ENSEMBL: ENSMUSP00000147407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000209746] [ENSMUST00000210947] [ENSMUST00000211403]

Predicted Effect

unknown
Transcript: ENSMUST00000048665
AA Change: I598F

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: I598F

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000109614
AA Change: I598F

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: I598F

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209203
AA Change: I598F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209341

Predicted Effect

unknown
Transcript: ENSMUST00000209423
AA Change: I598F

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209746
AA Change: I17F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210887

Predicted Effect

probably benign
Transcript: ENSMUST00000210947
AA Change: I125F

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211403
AA Change: I598F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,226,185	I247N	probably damaging	Het
Ankle1	G	T	8: 71,407,618	S260I	probably benign	Het
Aoc2	T	C	11: 101,325,192	S34P	probably benign	Het
Ap1m1	A	C	8: 72,256,122	I397L	possibly damaging	Het
Apba1	C	A	19: 23,936,561	D649E	probably damaging	Het
Aptx	C	T	4: 40,697,274	V25M	probably benign	Het
Arhgef18	G	A	8: 3,439,645	G326R	probably damaging	Het
Atm	A	C	9: 53,522,155	I265S	possibly damaging	Het
B3galt4	A	T	17: 33,951,213	V17E	probably benign	Het
Bcl7a	T	A	5: 123,356,023	M86K	possibly damaging	Het
Cela3a	T	A	4: 137,402,684		probably null	Het
Cep85	T	A	4: 134,148,728	K456*	probably null	Het
Ces1f	C	A	8: 93,275,414	A29S	probably benign	Het
Cntln	T	C	4: 84,947,635	L176S	probably damaging	Het
Cntn3	A	T	6: 102,170,668	N909K	probably damaging	Het
Cntnap5b	T	C	1: 100,076,107	S271P	probably damaging	Het
Col6a3	T	A	1: 90,773,502	H2564L	unknown	Het
Cyp2b19	C	A	7: 26,763,340		probably null	Het
Dapk1	G	T	13: 60,718,464		probably null	Het
Dnah7b	T	A	1: 46,324,712	Y3497*	probably null	Het
Duoxa2	T	C	2: 122,299,162		probably null	Het
Eny2	T	C	15: 44,432,478	W42R	probably damaging	Het
Epha3	A	G	16: 63,595,728	V635A	probably damaging	Het
Fam167b	G	C	4: 129,578,276	Q34E	probably benign	Het
Fam26f	A	G	10: 34,127,900	F4L	probably benign	Het
Fancm	T	C	12: 65,105,656	M962T	probably benign	Het
Gimap8	T	A	6: 48,656,411	I388N	probably benign	Het
Gpaa1	A	G	15: 76,331,453	T22A	probably benign	Het
Hoxc11	T	C	15: 102,955,156	S211P	possibly damaging	Het
Hsd17b12	T	C	2: 94,033,561	N312S	unknown	Het
Idh2	T	G	7: 80,099,158	E125A	probably damaging	Het
Igdcc4	A	G	9: 65,128,795	Y712C	probably damaging	Het
Kank1	T	C	19: 25,410,304	V447A	possibly damaging	Het
Kif1b	T	A	4: 149,195,501		probably null	Het
Klc4	A	T	17: 46,636,770	D335E	probably damaging	Het
Klhl33	T	A	14: 50,893,077	D320V	probably benign	Het
Krt73	A	T	15: 101,802,047	M84K	possibly damaging	Het
Kti12	T	A	4: 108,848,858	I323N	probably damaging	Het
Kynu	T	C	2: 43,679,825	L373P	probably damaging	Het
Lats1	T	C	10: 7,705,914	M821T	probably damaging	Het
Lnx1	A	T	5: 74,685,410	H126Q	probably benign	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc4b	T	A	7: 44,461,177	Y158N	probably damaging	Het
Lrrc74b	C	A	16: 17,559,753	R87L	probably damaging	Het
Meig1	T	C	2: 3,409,274	D63G	probably damaging	Het
Mrpl38	G	A	11: 116,138,429		probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nlrp1a	T	A	11: 71,142,358	E3D	unknown	Het
Nphs2	T	A	1: 156,320,898	D110E	probably damaging	Het
Nxn	T	A	11: 76,272,464	K244N	probably benign	Het
Oas3	A	T	5: 120,769,908	F322L	probably benign	Het
Obscn	T	A	11: 59,103,325	Y1577F	probably damaging	Het
Olfr1122	G	A	2: 87,388,620	R305K	possibly damaging	Het
Olfr911-ps1	T	A	9: 38,524,117	N128K	probably benign	Het
Olfr914	G	A	9: 38,606,948	G161D	probably damaging	Het
Olfr917	A	G	9: 38,665,320	Y175H	probably benign	Het
Olfr924	T	C	9: 38,848,513	M133T	probably damaging	Het
Panx1	T	C	9: 15,007,783	D260G	probably benign	Het
Pcdhb15	T	C	18: 37,473,813	Y33H	probably damaging	Het
Pik3ap1	C	A	19: 41,308,529	V461F	probably damaging	Het
Plpp3	G	A	4: 105,208,805		probably null	Het
Prtn3	A	T	10: 79,880,541	T61S	probably benign	Het
Psen1	T	A	12: 83,724,620	Y225N	probably damaging	Het
Rab44	T	A	17: 29,140,124	S429T	possibly damaging	Het
Ralgapa1	T	C	12: 55,762,603	I462M	probably benign	Het
Rbfox3	T	C	11: 118,505,669	N105S	probably damaging	Het
Rbm7	A	C	9: 48,489,721	Y236D	possibly damaging	Het
Samhd1	T	C	2: 157,101,732	T621A	probably benign	Het
Samt3	C	A	X: 86,046,650	D49E	probably benign	Het
Sass6	T	C	3: 116,603,473	V26A	possibly damaging	Het
Scn11a	C	T	9: 119,804,412	M418I	possibly damaging	Het
Scrib	T	C	15: 76,064,567	E480G	probably damaging	Het
Sec24a	T	G	11: 51,695,189	T1071P	probably damaging	Het
Siglecg	A	C	7: 43,408,941	E84A	probably benign	Het
Slc6a17	C	T	3: 107,474,386	V419I	probably damaging	Het
Soga1	T	C	2: 157,030,530	T966A	possibly damaging	Het
Ssr2	T	C	3: 88,581,042	M75T	possibly damaging	Het
Tbc1d22b	A	G	17: 29,575,177	T275A	possibly damaging	Het
Tbx15	T	A	3: 99,351,824		probably null	Het
Tll1	A	C	8: 64,085,551	L353R	possibly damaging	Het
Tlr4	C	T	4: 66,841,105	P712S	probably damaging	Het
Tmem145	T	A	7: 25,314,734	F424L	possibly damaging	Het
Tnrc18	T	C	5: 142,773,817	K755E	unknown	Het
Trmt44	A	G	5: 35,569,977	I298T	probably benign	Het
Vmn1r69	A	G	7: 10,580,252	V184A	probably benign	Het
Zfp84	T	C	7: 29,777,400	C506R	probably damaging	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91025392	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91005798	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91015846	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	90986132	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	90983490	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	90973207	missense	probably benign	0.29
IGL00908:Chd9	APN	8	90996880	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91051692	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91042116	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91026776	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	90933767	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91033510	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	90932488	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	90956494	nonsense	probably null
IGL02164:Chd9	APN	8	90933221	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91051684	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91033582	missense	probably benign	0.33
IGL02892:Chd9	APN	8	90976915	splice site	probably benign
IGL02897:Chd9	APN	8	90933868	splice site	probably benign
IGL03005:Chd9	APN	8	91011447	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91015267	splice site	probably benign
IGL03140:Chd9	APN	8	91042228	missense	possibly damaging	0.91
hovel	UTSW	8	91015204	missense	probably benign	0.19
shack	UTSW	8	90932798	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	90933537	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91008836	splice site	probably null
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	90994450	splice site	probably benign
R0454:Chd9	UTSW	8	90973231	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	90998595	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	90994563	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91036542	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	90977676	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91051197	missense	probably benign	0.06
R0945:Chd9	UTSW	8	90933002	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91015204	missense	probably benign	0.19
R0967:Chd9	UTSW	8	90989479	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	90932578	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	90986136	nonsense	probably null
R1244:Chd9	UTSW	8	91022929	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91006495	splice site	probably null
R1570:Chd9	UTSW	8	91036542	missense	probably benign	0.03
R1591:Chd9	UTSW	8	90983538	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	90998535	missense	probably benign	0.17
R1626:Chd9	UTSW	8	90994596	missense	probably benign	0.00
R1632:Chd9	UTSW	8	90956707	nonsense	probably null
R1649:Chd9	UTSW	8	90932601	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91022790	splice site	probably null
R1668:Chd9	UTSW	8	91041186	missense	probably damaging	0.99
R1695:Chd9	UTSW	8	91001782	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91034225	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91010698	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91010794	missense	probably benign	0.19
R1844:Chd9	UTSW	8	90956695	nonsense	probably null
R1941:Chd9	UTSW	8	90977069	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91035054	missense	probably benign	0.17
R2027:Chd9	UTSW	8	90907991	unclassified	probably benign
R2098:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91011285	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91051128	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91030460	splice site	probably null
R3418:Chd9	UTSW	8	91036591	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	90984265	splice site	probably benign
R3923:Chd9	UTSW	8	90933519	missense	probably benign	0.16
R4001:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	90933560	missense	probably benign	0.12
R4013:Chd9	UTSW	8	90973169	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91023574	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91010676	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	90977680	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	90978999	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91034031	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91036506	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	90983463	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91033800	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91015249	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91034230	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91033708	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91006626	nonsense	probably null
R5083:Chd9	UTSW	8	90984374	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	90977519	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91026834	nonsense	probably null
R5307:Chd9	UTSW	8	90997149	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91051504	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91015925	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91011450	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91036562	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91001756	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	90989450	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	90997164	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91051836	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	90978887	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91035063	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91049137	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	90932417	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	90932922	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91030546	missense	possibly damaging	0.93
R6348:Chd9	UTSW	8	91011275	missense	possibly damaging	0.95
R6438:Chd9	UTSW	8	90998521	missense	probably benign	0.02
R6470:Chd9	UTSW	8	90932798	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91051554	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91042951	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	90956416	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91042945	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	90978914	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91034215	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	90989561	missense	unknown
R7126:Chd9	UTSW	8	91015225	missense	unknown
R7182:Chd9	UTSW	8	91006622	missense	unknown
R7219:Chd9	UTSW	8	91001766	missense	unknown
R7260:Chd9	UTSW	8	90994543	missense	unknown
R7293:Chd9	UTSW	8	91034079	missense	unknown
R7303:Chd9	UTSW	8	91051904	missense	unknown
R7358:Chd9	UTSW	8	90983487	missense	unknown
R7358:Chd9	UTSW	8	91034218	missense	unknown
R7451:Chd9	UTSW	8	91033790	frame shift	probably null
R7451:Chd9	UTSW	8	91033818	missense	probably benign	0.27
R7456:Chd9	UTSW	8	90932525	nonsense	probably null
R7481:Chd9	UTSW	8	90956438	missense	unknown
R7532:Chd9	UTSW	8	90994565	missense	unknown
R7570:Chd9	UTSW	8	90994580	missense	unknown
R7611:Chd9	UTSW	8	91036389	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91051697	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91015209	missense	unknown
R7739:Chd9	UTSW	8	91035025	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	90977550	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91035056	nonsense	probably null
R7921:Chd9	UTSW	8	91042281	critical splice donor site	probably null
R7957:Chd9	UTSW	8	91051698	missense	probably damaging	0.99
R7972:Chd9	UTSW	8	91005767	missense	unknown
R8108:Chd9	UTSW	8	90933224	missense	unknown
R8115:Chd9	UTSW	8	91036332	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91041141	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91025387	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	90998605	missense	unknown
R8208:Chd9	UTSW	8	91037263	splice site	probably null
R8256:Chd9	UTSW	8	90933501	missense	unknown
R8281:Chd9	UTSW	8	91036597	missense	probably damaging	1.00
R8504:Chd9	UTSW	8	90996844	missense	unknown
RF007:Chd9	UTSW	8	91033950	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91036572	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCAAGCAATAGGACTCGACTCC -3'
(R):5'- TCCATGAGGCAACATTATGCTCCC -3'

Sequencing Primer
(F):5'- GGCTGCAACCAATCTATTAGAAG -3'
(R):5'- TGCTCCCTAAATAATTTCTAACAGTG -3'

Posted On

2014-05-09