Incidental Mutation 'R1681:Acaca'
ID 188533
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84117011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 247 (I247N)
Ref Sequence ENSEMBL: ENSMUSP00000117972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000130012]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: I247N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: I247N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: I247N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: I247N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130012
AA Change: I247N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117972
Gene: ENSMUSG00000020532
AA Change: I247N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 202 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183548
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCGCAATGCCGATTATGCTTT -3'
(R):5'- CCCAGGCCACATATTCTACTTAGCCTC -3'

Sequencing Primer
(F):5'- TGCTAGGTTTCCTAAGACCAAG -3'
(R):5'- agaacccaaaagccaggaag -3'
Posted On 2014-05-09