Incidental Mutation 'R1681:Fancm'
ID 188538
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene Name Fanconi anemia, complementation group M
Synonyms D12Ertd364e, C730036B14Rik
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 65122377-65178832 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65152430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 962 (M962T)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000221838] [ENSMUST00000222540]
AlphaFold Q8BGE5
Predicted Effect probably benign
Transcript: ENSMUST00000058889
AA Change: M962T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: M962T

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222521
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65,122,510 (GRCm39) missense possibly damaging 0.50
IGL00489:Fancm APN 12 65,152,967 (GRCm39) missense probably benign 0.01
IGL00529:Fancm APN 12 65,177,191 (GRCm39) utr 3 prime probably benign
IGL00898:Fancm APN 12 65,152,774 (GRCm39) missense probably benign 0.01
IGL01805:Fancm APN 12 65,160,635 (GRCm39) critical splice donor site probably null
IGL01986:Fancm APN 12 65,173,429 (GRCm39) nonsense probably null
IGL02026:Fancm APN 12 65,152,508 (GRCm39) missense probably benign 0.03
IGL02069:Fancm APN 12 65,122,685 (GRCm39) missense probably benign 0.05
IGL02103:Fancm APN 12 65,142,558 (GRCm39) missense probably benign 0.38
IGL02133:Fancm APN 12 65,153,249 (GRCm39) missense probably benign 0.04
IGL02400:Fancm APN 12 65,160,589 (GRCm39) missense probably damaging 1.00
IGL02478:Fancm APN 12 65,123,864 (GRCm39) missense probably damaging 1.00
IGL02479:Fancm APN 12 65,153,259 (GRCm39) missense probably damaging 0.98
IGL02563:Fancm APN 12 65,139,236 (GRCm39) missense probably damaging 1.00
IGL02606:Fancm APN 12 65,122,913 (GRCm39) missense possibly damaging 0.90
IGL02731:Fancm APN 12 65,135,079 (GRCm39) missense probably benign 0.00
IGL02809:Fancm APN 12 65,168,441 (GRCm39) missense possibly damaging 0.54
IGL02953:Fancm APN 12 65,168,740 (GRCm39) missense probably benign 0.27
IGL03066:Fancm APN 12 65,171,888 (GRCm39) nonsense probably null
IGL03073:Fancm APN 12 65,148,406 (GRCm39) missense probably damaging 1.00
Fancypants UTSW 12 65,153,235 (GRCm39) missense probably damaging 1.00
Mylord UTSW 12 65,163,197 (GRCm39) nonsense probably null
R0041_fancm_712 UTSW 12 65,153,217 (GRCm39) nonsense probably null
R7172_Fancm_370 UTSW 12 65,152,828 (GRCm39) missense possibly damaging 0.95
BB005:Fancm UTSW 12 65,152,898 (GRCm39) missense unknown
BB015:Fancm UTSW 12 65,152,898 (GRCm39) missense unknown
PIT4131001:Fancm UTSW 12 65,152,196 (GRCm39) missense probably benign 0.03
R0041:Fancm UTSW 12 65,153,217 (GRCm39) nonsense probably null
R0041:Fancm UTSW 12 65,153,217 (GRCm39) nonsense probably null
R0125:Fancm UTSW 12 65,168,730 (GRCm39) missense possibly damaging 0.68
R0201:Fancm UTSW 12 65,148,406 (GRCm39) missense probably damaging 1.00
R0360:Fancm UTSW 12 65,122,724 (GRCm39) missense probably damaging 1.00
R0491:Fancm UTSW 12 65,152,835 (GRCm39) missense probably benign 0.32
R0557:Fancm UTSW 12 65,165,216 (GRCm39) critical splice donor site probably null
R0617:Fancm UTSW 12 65,144,091 (GRCm39) nonsense probably null
R1201:Fancm UTSW 12 65,153,542 (GRCm39) missense possibly damaging 0.66
R1353:Fancm UTSW 12 65,134,944 (GRCm39) missense probably damaging 1.00
R1456:Fancm UTSW 12 65,165,125 (GRCm39) missense possibly damaging 0.48
R1468:Fancm UTSW 12 65,146,067 (GRCm39) missense probably damaging 1.00
R1468:Fancm UTSW 12 65,146,067 (GRCm39) missense probably damaging 1.00
R1521:Fancm UTSW 12 65,168,478 (GRCm39) missense probably benign 0.25
R1530:Fancm UTSW 12 65,139,264 (GRCm39) critical splice donor site probably null
R1559:Fancm UTSW 12 65,140,463 (GRCm39) missense probably benign 0.00
R1632:Fancm UTSW 12 65,177,105 (GRCm39) missense probably damaging 1.00
R1919:Fancm UTSW 12 65,152,294 (GRCm39) missense possibly damaging 0.48
R1969:Fancm UTSW 12 65,148,466 (GRCm39) missense probably benign 0.09
R1971:Fancm UTSW 12 65,148,466 (GRCm39) missense probably benign 0.09
R2117:Fancm UTSW 12 65,123,948 (GRCm39) missense probably damaging 1.00
R2510:Fancm UTSW 12 65,160,544 (GRCm39) splice site probably benign
R2909:Fancm UTSW 12 65,171,630 (GRCm39) missense probably damaging 1.00
R3155:Fancm UTSW 12 65,163,195 (GRCm39) missense probably benign 0.32
R3405:Fancm UTSW 12 65,122,546 (GRCm39) missense probably benign 0.00
R4133:Fancm UTSW 12 65,167,304 (GRCm39) missense probably benign 0.44
R4308:Fancm UTSW 12 65,173,305 (GRCm39) missense probably benign 0.14
R4588:Fancm UTSW 12 65,165,215 (GRCm39) critical splice donor site probably null
R4602:Fancm UTSW 12 65,171,718 (GRCm39) missense probably benign 0.12
R4653:Fancm UTSW 12 65,129,828 (GRCm39) missense probably damaging 0.99
R4702:Fancm UTSW 12 65,168,826 (GRCm39) missense possibly damaging 0.95
R4719:Fancm UTSW 12 65,168,480 (GRCm39) missense possibly damaging 0.64
R4885:Fancm UTSW 12 65,149,417 (GRCm39) nonsense probably null
R4896:Fancm UTSW 12 65,122,605 (GRCm39) missense probably damaging 1.00
R4908:Fancm UTSW 12 65,141,645 (GRCm39) missense probably benign 0.28
R4921:Fancm UTSW 12 65,123,915 (GRCm39) missense probably benign 0.19
R4922:Fancm UTSW 12 65,153,666 (GRCm39) critical splice donor site probably null
R4948:Fancm UTSW 12 65,137,748 (GRCm39) missense probably damaging 1.00
R5103:Fancm UTSW 12 65,152,632 (GRCm39) missense probably damaging 0.99
R5577:Fancm UTSW 12 65,177,185 (GRCm39) utr 3 prime probably benign
R5631:Fancm UTSW 12 65,160,617 (GRCm39) missense probably damaging 0.97
R5741:Fancm UTSW 12 65,148,389 (GRCm39) missense probably benign 0.01
R6137:Fancm UTSW 12 65,177,156 (GRCm39) missense probably damaging 1.00
R6167:Fancm UTSW 12 65,141,669 (GRCm39) missense probably benign 0.42
R6242:Fancm UTSW 12 65,163,216 (GRCm39) missense probably benign 0.01
R6242:Fancm UTSW 12 65,163,223 (GRCm39) missense probably benign 0.00
R6281:Fancm UTSW 12 65,135,044 (GRCm39) missense probably damaging 1.00
R6325:Fancm UTSW 12 65,171,826 (GRCm39) missense probably damaging 1.00
R6434:Fancm UTSW 12 65,123,942 (GRCm39) missense probably damaging 1.00
R6493:Fancm UTSW 12 65,144,262 (GRCm39) missense probably benign 0.04
R6542:Fancm UTSW 12 65,144,203 (GRCm39) missense probably damaging 1.00
R6645:Fancm UTSW 12 65,152,874 (GRCm39) missense probably damaging 0.99
R6878:Fancm UTSW 12 65,163,197 (GRCm39) nonsense probably null
R7171:Fancm UTSW 12 65,148,394 (GRCm39) missense probably damaging 0.99
R7172:Fancm UTSW 12 65,152,828 (GRCm39) missense possibly damaging 0.95
R7498:Fancm UTSW 12 65,146,165 (GRCm39) missense probably benign 0.01
R7585:Fancm UTSW 12 65,153,021 (GRCm39) missense possibly damaging 0.62
R7610:Fancm UTSW 12 65,152,454 (GRCm39) missense probably damaging 1.00
R7722:Fancm UTSW 12 65,153,235 (GRCm39) missense probably damaging 1.00
R7740:Fancm UTSW 12 65,173,321 (GRCm39) missense possibly damaging 0.90
R7867:Fancm UTSW 12 65,165,173 (GRCm39) missense probably benign 0.12
R7867:Fancm UTSW 12 65,163,240 (GRCm39) critical splice donor site probably null
R7882:Fancm UTSW 12 65,173,568 (GRCm39) missense probably benign 0.12
R7928:Fancm UTSW 12 65,152,898 (GRCm39) missense unknown
R8230:Fancm UTSW 12 65,149,424 (GRCm39) missense probably benign 0.17
R8470:Fancm UTSW 12 65,171,931 (GRCm39) missense probably damaging 1.00
R8553:Fancm UTSW 12 65,173,469 (GRCm39) missense possibly damaging 0.62
R8695:Fancm UTSW 12 65,171,947 (GRCm39) missense probably damaging 1.00
R8817:Fancm UTSW 12 65,167,331 (GRCm39) missense probably damaging 1.00
R8878:Fancm UTSW 12 65,173,522 (GRCm39) missense probably damaging 1.00
R9027:Fancm UTSW 12 65,122,605 (GRCm39) missense probably damaging 1.00
R9223:Fancm UTSW 12 65,149,358 (GRCm39) missense probably benign 0.12
R9280:Fancm UTSW 12 65,153,612 (GRCm39) missense probably benign 0.16
R9487:Fancm UTSW 12 65,153,388 (GRCm39) nonsense probably null
R9562:Fancm UTSW 12 65,168,494 (GRCm39) missense probably damaging 1.00
R9565:Fancm UTSW 12 65,168,494 (GRCm39) missense probably damaging 1.00
R9575:Fancm UTSW 12 65,152,314 (GRCm39) missense possibly damaging 0.88
R9664:Fancm UTSW 12 65,137,758 (GRCm39) missense probably benign 0.08
Z1176:Fancm UTSW 12 65,141,700 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGGTGCTGTCACTGAAGAGGATAAC -3'
(R):5'- TCGCTATCAGACTCACAGAAGGAGG -3'

Sequencing Primer
(F):5'- GTCACTGAAGAGGATAACCATCCAG -3'
(R):5'- ATTCCCAGCAGAGTGTGAC -3'
Posted On 2014-05-09