Mutagenetix > Incidental Mutation

Incidental Mutation 'R1681:Psen1'

188539

Institutional Source

Beutler Lab

Gene Symbol

Psen1

Ensembl Gene

ENSMUSG00000019969

Gene Name

presenilin 1

Synonyms

PS1, PS-1, S182, presenilin-1, Ad3h

MMRRC Submission

039717-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1681 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83688152-83735199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83724620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 225 (Y225N)

Ref Sequence

ENSEMBL: ENSMUSP00000098786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041806] [ENSMUST00000101225]

AlphaFold

P49769

Predicted Effect

probably damaging
Transcript: ENSMUST00000041806
AA Change: Y225N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048363
Gene: ENSMUSG00000019969
AA Change: Y225N

Domain	Start	End	E-Value	Type
low complexity region	61	72	N/A	INTRINSIC
Blast:PSN	75	113	1e-12	BLAST
PSN	130	453	2.03e-150	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101225
AA Change: Y225N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098786
Gene: ENSMUSG00000019969
AA Change: Y225N

Domain	Start	End	E-Value	Type
low complexity region	61	72	N/A	INTRINSIC
Blast:PSN	75	113	1e-12	BLAST
PSN	130	453	2.03e-150	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221993

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deformed axial skeletons, reduced Notch signaling, impaired brain growth with a deficiency of neural stem cells, cerebral hemorrhages, inhibited cleavage of amyloid precursor protein, and perinatal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,226,185	I247N	probably damaging	Het
Ankle1	G	T	8: 71,407,618	S260I	probably benign	Het
Aoc2	T	C	11: 101,325,192	S34P	probably benign	Het
Ap1m1	A	C	8: 72,256,122	I397L	possibly damaging	Het
Apba1	C	A	19: 23,936,561	D649E	probably damaging	Het
Aptx	C	T	4: 40,697,274	V25M	probably benign	Het
Arhgef18	G	A	8: 3,439,645	G326R	probably damaging	Het
Atm	A	C	9: 53,522,155	I265S	possibly damaging	Het
B3galt4	A	T	17: 33,951,213	V17E	probably benign	Het
Bcl7a	T	A	5: 123,356,023	M86K	possibly damaging	Het
Cela3a	T	A	4: 137,402,684		probably null	Het
Cep85	T	A	4: 134,148,728	K456*	probably null	Het
Ces1f	C	A	8: 93,275,414	A29S	probably benign	Het
Chd9	A	T	8: 90,973,135	I598F	probably damaging	Het
Cntln	T	C	4: 84,947,635	L176S	probably damaging	Het
Cntn3	A	T	6: 102,170,668	N909K	probably damaging	Het
Cntnap5b	T	C	1: 100,076,107	S271P	probably damaging	Het
Col6a3	T	A	1: 90,773,502	H2564L	unknown	Het
Cyp2b19	C	A	7: 26,763,340		probably null	Het
Dapk1	G	T	13: 60,718,464		probably null	Het
Dnah7b	T	A	1: 46,324,712	Y3497*	probably null	Het
Duoxa2	T	C	2: 122,299,162		probably null	Het
Eny2	T	C	15: 44,432,478	W42R	probably damaging	Het
Epha3	A	G	16: 63,595,728	V635A	probably damaging	Het
Fam167b	G	C	4: 129,578,276	Q34E	probably benign	Het
Fam26f	A	G	10: 34,127,900	F4L	probably benign	Het
Fancm	T	C	12: 65,105,656	M962T	probably benign	Het
Gimap8	T	A	6: 48,656,411	I388N	probably benign	Het
Gpaa1	A	G	15: 76,331,453	T22A	probably benign	Het
Hoxc11	T	C	15: 102,955,156	S211P	possibly damaging	Het
Hsd17b12	T	C	2: 94,033,561	N312S	unknown	Het
Idh2	T	G	7: 80,099,158	E125A	probably damaging	Het
Igdcc4	A	G	9: 65,128,795	Y712C	probably damaging	Het
Kank1	T	C	19: 25,410,304	V447A	possibly damaging	Het
Kif1b	T	A	4: 149,195,501		probably null	Het
Klc4	A	T	17: 46,636,770	D335E	probably damaging	Het
Klhl33	T	A	14: 50,893,077	D320V	probably benign	Het
Krt73	A	T	15: 101,802,047	M84K	possibly damaging	Het
Kti12	T	A	4: 108,848,858	I323N	probably damaging	Het
Kynu	T	C	2: 43,679,825	L373P	probably damaging	Het
Lats1	T	C	10: 7,705,914	M821T	probably damaging	Het
Lnx1	A	T	5: 74,685,410	H126Q	probably benign	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc4b	T	A	7: 44,461,177	Y158N	probably damaging	Het
Lrrc74b	C	A	16: 17,559,753	R87L	probably damaging	Het
Meig1	T	C	2: 3,409,274	D63G	probably damaging	Het
Mrpl38	G	A	11: 116,138,429		probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nlrp1a	T	A	11: 71,142,358	E3D	unknown	Het
Nphs2	T	A	1: 156,320,898	D110E	probably damaging	Het
Nxn	T	A	11: 76,272,464	K244N	probably benign	Het
Oas3	A	T	5: 120,769,908	F322L	probably benign	Het
Obscn	T	A	11: 59,103,325	Y1577F	probably damaging	Het
Olfr1122	G	A	2: 87,388,620	R305K	possibly damaging	Het
Olfr911-ps1	T	A	9: 38,524,117	N128K	probably benign	Het
Olfr914	G	A	9: 38,606,948	G161D	probably damaging	Het
Olfr917	A	G	9: 38,665,320	Y175H	probably benign	Het
Olfr924	T	C	9: 38,848,513	M133T	probably damaging	Het
Panx1	T	C	9: 15,007,783	D260G	probably benign	Het
Pcdhb15	T	C	18: 37,473,813	Y33H	probably damaging	Het
Pik3ap1	C	A	19: 41,308,529	V461F	probably damaging	Het
Plpp3	G	A	4: 105,208,805		probably null	Het
Prtn3	A	T	10: 79,880,541	T61S	probably benign	Het
Rab44	T	A	17: 29,140,124	S429T	possibly damaging	Het
Ralgapa1	T	C	12: 55,762,603	I462M	probably benign	Het
Rbfox3	T	C	11: 118,505,669	N105S	probably damaging	Het
Rbm7	A	C	9: 48,489,721	Y236D	possibly damaging	Het
Samhd1	T	C	2: 157,101,732	T621A	probably benign	Het
Samt3	C	A	X: 86,046,650	D49E	probably benign	Het
Sass6	T	C	3: 116,603,473	V26A	possibly damaging	Het
Scn11a	C	T	9: 119,804,412	M418I	possibly damaging	Het
Scrib	T	C	15: 76,064,567	E480G	probably damaging	Het
Sec24a	T	G	11: 51,695,189	T1071P	probably damaging	Het
Siglecg	A	C	7: 43,408,941	E84A	probably benign	Het
Slc6a17	C	T	3: 107,474,386	V419I	probably damaging	Het
Soga1	T	C	2: 157,030,530	T966A	possibly damaging	Het
Ssr2	T	C	3: 88,581,042	M75T	possibly damaging	Het
Tbc1d22b	A	G	17: 29,575,177	T275A	possibly damaging	Het
Tbx15	T	A	3: 99,351,824		probably null	Het
Tll1	A	C	8: 64,085,551	L353R	possibly damaging	Het
Tlr4	C	T	4: 66,841,105	P712S	probably damaging	Het
Tmem145	T	A	7: 25,314,734	F424L	possibly damaging	Het
Tnrc18	T	C	5: 142,773,817	K755E	unknown	Het
Trmt44	A	G	5: 35,569,977	I298T	probably benign	Het
Vmn1r69	A	G	7: 10,580,252	V184A	probably benign	Het
Zfp84	T	C	7: 29,777,400	C506R	probably damaging	Het

Other mutations in Psen1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Psen1	APN	12	83730569	missense	probably benign	0.01
IGL00793:Psen1	APN	12	83723018	missense	probably damaging	0.98
IGL03171:Psen1	APN	12	83714864	missense	probably damaging	1.00
hiortron	UTSW	12	83724665	missense	probably damaging	1.00
R0685:Psen1	UTSW	12	83714820	nonsense	probably null
R1394:Psen1	UTSW	12	83724572	missense	probably damaging	1.00
R1395:Psen1	UTSW	12	83724572	missense	probably damaging	1.00
R2257:Psen1	UTSW	12	83714820	missense	probably damaging	1.00
R4833:Psen1	UTSW	12	83731778	missense	probably benign	0.23
R5077:Psen1	UTSW	12	83724665	missense	probably damaging	1.00
R5170:Psen1	UTSW	12	83714862	missense	probably damaging	1.00
R5782:Psen1	UTSW	12	83712459	missense	possibly damaging	0.54
R5804:Psen1	UTSW	12	83731700	missense	probably damaging	1.00
R7458:Psen1	UTSW	12	83714766	missense	probably damaging	1.00
R7494:Psen1	UTSW	12	83728243	missense	probably benign	0.19
R7797:Psen1	UTSW	12	83699622	missense	probably benign	0.02
R8547:Psen1	UTSW	12	83714856	missense	possibly damaging	0.68
R9286:Psen1	UTSW	12	83728775	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAGGTCCATCCCAGCTTCACAC -3'
(R):5'- AAAGCACACCAGTGAGTGAGTCTG -3'

Sequencing Primer
(F):5'- acataaataacagcacagcatagg -3'
(R):5'- CTGTGATGGACAAAGTGTCAGTC -3'

Posted On

2014-05-09