Incidental Mutation 'R1681:Hoxc11'
ID 188550
Institutional Source Beutler Lab
Gene Symbol Hoxc11
Ensembl Gene ENSMUSG00000001656
Gene Name homeobox C11
Synonyms Hox-3.7
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.684) question?
Stock # R1681 (G1)
Quality Score 119
Status Not validated
Chromosome 15
Chromosomal Location 102954427-102957708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102955156 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000001701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001701]
AlphaFold P31313
Predicted Effect possibly damaging
Transcript: ENSMUST00000001701
AA Change: S211P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001701
Gene: ENSMUSG00000001656
AA Change: S211P

DomainStartEndE-ValueType
Pfam:DUF3528 42 178 5.2e-52 PFAM
low complexity region 193 204 N/A INTRINSIC
low complexity region 209 216 N/A INTRINSIC
HOX 232 294 1.66e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene binds to a promoter element of the lactase-phlorizin hydrolase. It also may play a role in early intestinal development. An alternatively spliced variant encoding a shorter isoform has been described but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 (GRCm38) I247N probably damaging Het
Ankle1 G T 8: 71,407,618 (GRCm38) S260I probably benign Het
Aoc2 T C 11: 101,325,192 (GRCm38) S34P probably benign Het
Ap1m1 A C 8: 72,256,122 (GRCm38) I397L possibly damaging Het
Apba1 C A 19: 23,936,561 (GRCm38) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm38) V25M probably benign Het
Arhgef18 G A 8: 3,439,645 (GRCm38) G326R probably damaging Het
Atm A C 9: 53,522,155 (GRCm38) I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 (GRCm38) V17E probably benign Het
Bcl7a T A 5: 123,356,023 (GRCm38) M86K possibly damaging Het
Cela3a T A 4: 137,402,684 (GRCm38) probably null Het
Cep85 T A 4: 134,148,728 (GRCm38) K456* probably null Het
Ces1f C A 8: 93,275,414 (GRCm38) A29S probably benign Het
Chd9 A T 8: 90,973,135 (GRCm38) I598F probably damaging Het
Cntln T C 4: 84,947,635 (GRCm38) L176S probably damaging Het
Cntn3 A T 6: 102,170,668 (GRCm38) N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 (GRCm38) S271P probably damaging Het
Col6a3 T A 1: 90,773,502 (GRCm38) H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 (GRCm38) probably null Het
Dapk1 G T 13: 60,718,464 (GRCm38) probably null Het
Dnah7b T A 1: 46,324,712 (GRCm38) Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 (GRCm38) probably null Het
Eny2 T C 15: 44,432,478 (GRCm38) W42R probably damaging Het
Epha3 A G 16: 63,595,728 (GRCm38) V635A probably damaging Het
Fam167b G C 4: 129,578,276 (GRCm38) Q34E probably benign Het
Fam26f A G 10: 34,127,900 (GRCm38) F4L probably benign Het
Fancm T C 12: 65,105,656 (GRCm38) M962T probably benign Het
Gimap8 T A 6: 48,656,411 (GRCm38) I388N probably benign Het
Gpaa1 A G 15: 76,331,453 (GRCm38) T22A probably benign Het
Hsd17b12 T C 2: 94,033,561 (GRCm38) N312S unknown Het
Idh2 T G 7: 80,099,158 (GRCm38) E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 (GRCm38) Y712C probably damaging Het
Kank1 T C 19: 25,410,304 (GRCm38) V447A possibly damaging Het
Kif1b T A 4: 149,195,501 (GRCm38) probably null Het
Klc4 A T 17: 46,636,770 (GRCm38) D335E probably damaging Het
Klhl33 T A 14: 50,893,077 (GRCm38) D320V probably benign Het
Krt73 A T 15: 101,802,047 (GRCm38) M84K possibly damaging Het
Kti12 T A 4: 108,848,858 (GRCm38) I323N probably damaging Het
Kynu T C 2: 43,679,825 (GRCm38) L373P probably damaging Het
Lats1 T C 10: 7,705,914 (GRCm38) M821T probably damaging Het
Lnx1 A T 5: 74,685,410 (GRCm38) H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 (GRCm38) P165S probably benign Het
Lrrc4b T A 7: 44,461,177 (GRCm38) Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 (GRCm38) R87L probably damaging Het
Meig1 T C 2: 3,409,274 (GRCm38) D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 (GRCm38) probably benign Het
Naip2 T C 13: 100,161,854 (GRCm38) E558G probably benign Het
Naip2 C T 13: 100,161,860 (GRCm38) G556D probably benign Het
Nlrp1a T A 11: 71,142,358 (GRCm38) E3D unknown Het
Nphs2 T A 1: 156,320,898 (GRCm38) D110E probably damaging Het
Nxn T A 11: 76,272,464 (GRCm38) K244N probably benign Het
Oas3 A T 5: 120,769,908 (GRCm38) F322L probably benign Het
Obscn T A 11: 59,103,325 (GRCm38) Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 (GRCm38) R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 (GRCm38) N128K probably benign Het
Olfr914 G A 9: 38,606,948 (GRCm38) G161D probably damaging Het
Olfr917 A G 9: 38,665,320 (GRCm38) Y175H probably benign Het
Olfr924 T C 9: 38,848,513 (GRCm38) M133T probably damaging Het
Panx1 T C 9: 15,007,783 (GRCm38) D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 (GRCm38) Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 (GRCm38) V461F probably damaging Het
Plpp3 G A 4: 105,208,805 (GRCm38) probably null Het
Prtn3 A T 10: 79,880,541 (GRCm38) T61S probably benign Het
Psen1 T A 12: 83,724,620 (GRCm38) Y225N probably damaging Het
Rab44 T A 17: 29,140,124 (GRCm38) S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 (GRCm38) I462M probably benign Het
Rbfox3 T C 11: 118,505,669 (GRCm38) N105S probably damaging Het
Rbm7 A C 9: 48,489,721 (GRCm38) Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 (GRCm38) T621A probably benign Het
Samt3 C A X: 86,046,650 (GRCm38) D49E probably benign Het
Sass6 T C 3: 116,603,473 (GRCm38) V26A possibly damaging Het
Scn11a C T 9: 119,804,412 (GRCm38) M418I possibly damaging Het
Scrib T C 15: 76,064,567 (GRCm38) E480G probably damaging Het
Sec24a T G 11: 51,695,189 (GRCm38) T1071P probably damaging Het
Siglecg A C 7: 43,408,941 (GRCm38) E84A probably benign Het
Slc6a17 C T 3: 107,474,386 (GRCm38) V419I probably damaging Het
Soga1 T C 2: 157,030,530 (GRCm38) T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 (GRCm38) M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 (GRCm38) T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 (GRCm38) probably null Het
Tll1 A C 8: 64,085,551 (GRCm38) L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 (GRCm38) P712S probably damaging Het
Tmem145 T A 7: 25,314,734 (GRCm38) F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 (GRCm38) K755E unknown Het
Trmt44 A G 5: 35,569,977 (GRCm38) I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 (GRCm38) V184A probably benign Het
Zfp84 T C 7: 29,777,400 (GRCm38) C506R probably damaging Het
Other mutations in Hoxc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03122:Hoxc11 APN 15 102,954,955 (GRCm38) missense probably damaging 1.00
IGL03261:Hoxc11 APN 15 102,954,743 (GRCm38) missense probably benign 0.36
R0008:Hoxc11 UTSW 15 102,954,962 (GRCm38) missense probably damaging 1.00
R0008:Hoxc11 UTSW 15 102,954,962 (GRCm38) missense probably damaging 1.00
R0157:Hoxc11 UTSW 15 102,955,001 (GRCm38) missense probably damaging 1.00
R1055:Hoxc11 UTSW 15 102,954,835 (GRCm38) missense probably damaging 1.00
R4342:Hoxc11 UTSW 15 102,954,671 (GRCm38) missense probably damaging 1.00
R6285:Hoxc11 UTSW 15 102,954,743 (GRCm38) missense probably benign 0.36
R6558:Hoxc11 UTSW 15 102,954,866 (GRCm38) missense probably damaging 1.00
R7211:Hoxc11 UTSW 15 102,955,052 (GRCm38) missense possibly damaging 0.82
R8346:Hoxc11 UTSW 15 102,954,751 (GRCm38) missense possibly damaging 0.93
R8348:Hoxc11 UTSW 15 102,954,751 (GRCm38) missense possibly damaging 0.93
R8423:Hoxc11 UTSW 15 102,954,742 (GRCm38) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AACAGCGTCTTGCCCCAAGCTTTC -3'
(R):5'- TAATATCGCCCGCAATGGTGGCAC -3'

Sequencing Primer
(F):5'- CGACCGCTTCTTCGACAAC -3'
(R):5'- CCATCGTAAAAAGTCGAGTCGTTG -3'
Posted On 2014-05-09