Incidental Mutation 'R1681:Lrrc74b'
ID 188551
Institutional Source Beutler Lab
Gene Symbol Lrrc74b
Ensembl Gene ENSMUSG00000022759
Gene Name leucine rich repeat containing 74B
Synonyms 4930451C15Rik
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17362329-17379111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 17377617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 87 (R87L)
Ref Sequence ENSEMBL: ENSMUSP00000097699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000023442] [ENSMUST00000065125] [ENSMUST00000100123] [ENSMUST00000171002] [ENSMUST00000231806] [ENSMUST00000232637]
AlphaFold Q14BP6
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023442
AA Change: R87L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023442
Gene: ENSMUSG00000022759
AA Change: R87L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
low complexity region 342 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065125
AA Change: R87L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070127
Gene: ENSMUSG00000022759
AA Change: R87L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100123
AA Change: R87L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097699
Gene: ENSMUSG00000022759
AA Change: R87L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
LRR 300 327 4.16e0 SMART
low complexity region 374 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect possibly damaging
Transcript: ENSMUST00000232637
AA Change: R87L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntln T C 4: 84,865,872 (GRCm39) L176S probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Lrrc74b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Lrrc74b APN 16 17,363,422 (GRCm39) missense probably benign 0.00
IGL02402:Lrrc74b APN 16 17,376,028 (GRCm39) splice site probably benign
P0043:Lrrc74b UTSW 16 17,376,023 (GRCm39) splice site probably benign
R0131:Lrrc74b UTSW 16 17,371,016 (GRCm39) missense probably damaging 1.00
R0131:Lrrc74b UTSW 16 17,371,016 (GRCm39) missense probably damaging 1.00
R0132:Lrrc74b UTSW 16 17,371,016 (GRCm39) missense probably damaging 1.00
R0829:Lrrc74b UTSW 16 17,376,254 (GRCm39) splice site probably benign
R1463:Lrrc74b UTSW 16 17,377,737 (GRCm39) missense probably benign 0.00
R1938:Lrrc74b UTSW 16 17,371,058 (GRCm39) missense probably benign 0.41
R4790:Lrrc74b UTSW 16 17,367,717 (GRCm39) missense probably damaging 1.00
R5428:Lrrc74b UTSW 16 17,376,125 (GRCm39) missense probably damaging 0.99
R6198:Lrrc74b UTSW 16 17,366,650 (GRCm39) missense probably damaging 0.96
R7910:Lrrc74b UTSW 16 17,376,213 (GRCm39) nonsense probably null
R8233:Lrrc74b UTSW 16 17,376,089 (GRCm39) missense probably benign 0.00
R8957:Lrrc74b UTSW 16 17,378,976 (GRCm39) missense probably benign 0.09
R9030:Lrrc74b UTSW 16 17,367,640 (GRCm39) critical splice donor site probably null
X0063:Lrrc74b UTSW 16 17,371,072 (GRCm39) missense probably benign 0.05
Z1177:Lrrc74b UTSW 16 17,376,036 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc74b UTSW 16 17,376,032 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATCAGCTTCTACCTTTAGGTGCCG -3'
(R):5'- GGCTATGCCAGTGATTCGTTCCTTC -3'

Sequencing Primer
(F):5'- TTAGGTGCCGCCCAATC -3'
(R):5'- CTTCATCTCCCATCTACTGCTAGG -3'
Posted On 2014-05-09