Incidental Mutation 'R1681:Kank1'
ID188561
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1681 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25410304 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049400
AA Change: V419A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V419A

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137260
Predicted Effect possibly damaging
Transcript: ENSMUST00000146647
AA Change: V447A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V447A

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
R7602:Kank1 UTSW 19 25422161 missense probably benign 0.01
R7701:Kank1 UTSW 19 25411765 critical splice donor site probably null
R7765:Kank1 UTSW 19 25411205 frame shift probably null
R7766:Kank1 UTSW 19 25411205 frame shift probably null
R7768:Kank1 UTSW 19 25411205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGGGAATTGTACATCGACTACGAG -3'
(R):5'- TTGCTGAAGACAAGTGGCTGGG -3'

Sequencing Primer
(F):5'- CGTAGAGCAGAGCACGC -3'
(R):5'- AGCTGTACTTCTAGGCGGTAAATC -3'
Posted On2014-05-09