Incidental Mutation 'R1402:Bves'
ID 188572
Institutional Source Beutler Lab
Gene Symbol Bves
Ensembl Gene ENSMUSG00000071317
Gene Name blood vessel epicardial substance
Synonyms Popdc1, popeye 1
MMRRC Submission 039464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1402 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 45335772-45372479 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45347865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 207 (T207M)
Ref Sequence ENSEMBL: ENSMUSP00000093382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095715]
AlphaFold Q9ES83
Predicted Effect probably damaging
Transcript: ENSMUST00000095715
AA Change: T207M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093382
Gene: ENSMUSG00000071317
AA Change: T207M

DomainStartEndE-ValueType
Pfam:Popeye 40 267 3e-90 PFAM
low complexity region 313 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in delayed muscle regeneration following induced injury. Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp8 T A 7: 123,466,639 V219E probably damaging Het
Birc6 T A 17: 74,697,533 probably benign Het
Dlg5 T C 14: 24,176,608 S409G probably benign Het
Ehmt2 C T 17: 34,906,781 T607I probably benign Het
H2-T22 A T 17: 36,040,269 I307N possibly damaging Het
Itih3 T C 14: 30,908,708 D882G probably damaging Het
Kmt5c G T 7: 4,742,253 R81L possibly damaging Het
Mcm3ap C T 10: 76,477,914 probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nr1i2 A G 16: 38,252,883 S244P probably damaging Het
Pcx A G 19: 4,602,030 D101G possibly damaging Het
Prkch T C 12: 73,585,389 V76A probably damaging Het
Thsd1 A G 8: 22,259,368 K691E possibly damaging Het
Tmprss11e G A 5: 86,715,618 T196I probably damaging Het
Trappc13 A G 13: 104,150,116 V211A probably damaging Het
Ttc37 A G 13: 76,131,414 Y655C probably damaging Het
Vav1 C A 17: 57,303,849 L472I probably benign Het
Wdr25 G A 12: 109,026,539 E459K probably damaging Het
Zdbf2 A T 1: 63,303,627 E388D possibly damaging Het
Zfp663 T C 2: 165,353,970 K110E probably benign Het
Zfp78 C A 7: 6,378,619 H223N probably damaging Het
Other mutations in Bves
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Bves APN 10 45353848 missense probably damaging 1.00
IGL01155:Bves APN 10 45353859 missense probably damaging 1.00
IGL01482:Bves APN 10 45354806 missense possibly damaging 0.68
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1564:Bves UTSW 10 45369281 missense probably benign 0.03
R1711:Bves UTSW 10 45347865 missense probably damaging 1.00
R1742:Bves UTSW 10 45347865 missense probably damaging 1.00
R2057:Bves UTSW 10 45343135 missense probably damaging 1.00
R3113:Bves UTSW 10 45343052 missense probably benign 0.01
R3546:Bves UTSW 10 45354811 missense probably damaging 1.00
R4400:Bves UTSW 10 45369293 missense probably benign
R4612:Bves UTSW 10 45339277 missense probably benign 0.01
R4687:Bves UTSW 10 45354840 splice site probably null
R6994:Bves UTSW 10 45339418 missense probably benign
R7052:Bves UTSW 10 45346290 missense possibly damaging 0.69
R7179:Bves UTSW 10 45354817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTGGAGTCTTTAAAACCAGGACA -3'
(R):5'- TCCAGTTGTGGACATACTGTTGAAAGC -3'

Sequencing Primer
(F):5'- CCAGGACAACTCCATTATTGCTATG -3'
(R):5'- CTGTTGAAAGCTGAAAACACTGTTG -3'
Posted On 2014-05-09