Incidental Mutation 'R1403:Fam124b'
ID188587
Institutional Source Beutler Lab
Gene Symbol Fam124b
Ensembl Gene ENSMUSG00000043230
Gene Namefamily with sequence similarity 124, member B
Synonyms
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80198706-80218473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80213339 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 109 (Y109C)
Ref Sequence ENSEMBL: ENSMUSP00000052208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058748
AA Change: Y109C

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052208
Gene: ENSMUSG00000043230
AA Change: Y109C

DomainStartEndE-ValueType
Pfam:FAM124 10 244 1.2e-107 PFAM
low complexity region 288 297 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161427
Meta Mutation Damage Score 0.5776 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Fam124b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam124b APN 1 80213135 missense possibly damaging 0.95
IGL03384:Fam124b APN 1 80199956 missense probably benign
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R0233:Fam124b UTSW 1 80212986 missense probably damaging 1.00
R1403:Fam124b UTSW 1 80213339 missense possibly damaging 0.57
R1514:Fam124b UTSW 1 80200431 missense possibly damaging 0.82
R1569:Fam124b UTSW 1 80213135 missense possibly damaging 0.95
R1983:Fam124b UTSW 1 80213647 missense probably benign 0.03
R3104:Fam124b UTSW 1 80213031 missense probably damaging 1.00
R4640:Fam124b UTSW 1 80213526 missense probably damaging 1.00
R5014:Fam124b UTSW 1 80200059 missense probably benign 0.00
R6180:Fam124b UTSW 1 80200185 missense possibly damaging 0.71
R7618:Fam124b UTSW 1 80213837 start gained probably benign
R7682:Fam124b UTSW 1 80213565 missense possibly damaging 0.87
R7720:Fam124b UTSW 1 80200257 missense probably damaging 1.00
R7812:Fam124b UTSW 1 80213634 missense probably damaging 1.00
R7877:Fam124b UTSW 1 80213336 missense probably damaging 1.00
R7898:Fam124b UTSW 1 80213795 start gained probably benign
R7989:Fam124b UTSW 1 80213594 missense probably damaging 1.00
T0975:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0005:Fam124b UTSW 1 80213126 missense probably benign 0.06
X0062:Fam124b UTSW 1 80212961 missense probably damaging 1.00
Z1176:Fam124b UTSW 1 80213403 missense possibly damaging 0.58
Z1177:Fam124b UTSW 1 80200088 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCAATCTCTTGAACCCTGAAC -3'
(R):5'- ATCTTCTTGCCGACACTGGGAAC -3'

Sequencing Primer
(F):5'- AGAAGTCGCTCTTTTGCACAG -3'
(R):5'- CTACTAGAATGTATCTGCCCAGAGG -3'
Posted On2014-05-09