Incidental Mutation 'R1403:Wdr77'
ID188594
Institutional Source Beutler Lab
Gene Symbol Wdr77
Ensembl Gene ENSMUSG00000000561
Gene NameWD repeat domain 77
Synonyms2610003I18Rik, 2610312E17Rik, p44/MEP50
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105959369-105970037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105967257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 322 (V322I)
Ref Sequence ENSEMBL: ENSMUSP00000010278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010278] [ENSMUST00000128005] [ENSMUST00000130994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010278
AA Change: V322I

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000010278
Gene: ENSMUSG00000000561
AA Change: V322I

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
WD40 70 107 5.11e1 SMART
WD40 115 153 1.06e-3 SMART
WD40 156 196 4.51e-7 SMART
WD40 201 241 2.75e1 SMART
WD40 244 284 9.94e-1 SMART
WD40 286 326 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127464
Predicted Effect probably benign
Transcript: ENSMUST00000128005
SMART Domains Protein: ENSMUSP00000122465
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
WD40 13 51 1.06e-3 SMART
WD40 54 94 4.51e-7 SMART
WD40 99 139 2.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130994
SMART Domains Protein: ENSMUSP00000120517
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
PDB:4GQB|B 1 52 8e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.2536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an androgen receptor coactivator that forms a complex with protein arginine methyltransferase 5, which modifies specific arginines to dimethylarginines in several spliceosomal Sm proteins. The encoded protein may be involved in the early stages of prostate cancer, with most of the protein being nuclear-localized in benign cells but cytoplasmic in cancer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to E8.5 for unknown reasons. Heterozygotes develop multifocal hyperplasia in the dorsal prostate; however, no prostate tumors are detected up to 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Wdr77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Wdr77 APN 3 105959686 nonsense probably null
R0368:Wdr77 UTSW 3 105962066 critical splice donor site probably null
R0436:Wdr77 UTSW 3 105960026 missense probably damaging 1.00
R1403:Wdr77 UTSW 3 105967257 missense possibly damaging 0.76
R1928:Wdr77 UTSW 3 105967302 missense probably benign 0.00
R2422:Wdr77 UTSW 3 105960021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCCAGCTTGATTTAGGGAGCCAC -3'
(R):5'- TGAGAATCTGCCTGTTACTGCACG -3'

Sequencing Primer
(F):5'- TCCACTGTGTCTTCACCTAAGAAAG -3'
(R):5'- TTACTGCACGGGGCTAGG -3'
Posted On2014-05-09