Incidental Mutation 'R1403:Mterf3'
ID188625
Institutional Source Beutler Lab
Gene Symbol Mterf3
Ensembl Gene ENSMUSG00000021519
Gene Namemitochondrial transcription termination factor 3
Synonyms2410017I18Rik, Mterfd1
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location66906968-66933088 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 66929880 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000021991] [ENSMUST00000172597] [ENSMUST00000173158] [ENSMUST00000173407] [ENSMUST00000173773] [ENSMUST00000173910] [ENSMUST00000174339] [ENSMUST00000224085] [ENSMUST00000224244] [ENSMUST00000224290]
Predicted Effect probably benign
Transcript: ENSMUST00000021990
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021991
SMART Domains Protein: ENSMUSP00000021991
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Mterf 161 196 1.63e3 SMART
Mterf 201 231 7.37e-1 SMART
Mterf 236 267 4.68e-3 SMART
Mterf 272 303 2.12e-1 SMART
Mterf 308 339 4.11e1 SMART
Mterf 340 370 9.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172597
SMART Domains Protein: ENSMUSP00000133433
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
PDB:3OPG|A 121 204 2e-40 PDB
Blast:Mterf 161 196 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173062
Predicted Effect probably benign
Transcript: ENSMUST00000173158
SMART Domains Protein: ENSMUSP00000134032
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173407
SMART Domains Protein: ENSMUSP00000133594
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173773
Predicted Effect probably benign
Transcript: ENSMUST00000173910
SMART Domains Protein: ENSMUSP00000133456
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174011
Predicted Effect probably benign
Transcript: ENSMUST00000174339
SMART Domains Protein: ENSMUSP00000134286
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224085
Predicted Effect probably benign
Transcript: ENSMUST00000224244
Predicted Effect probably benign
Transcript: ENSMUST00000224290
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit embryonic growth retardation and die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Mterf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03106:Mterf3 APN 13 66930157 missense probably damaging 1.00
R0630:Mterf3 UTSW 13 66912308 missense probably damaging 1.00
R0636:Mterf3 UTSW 13 66922753 intron probably benign
R1447:Mterf3 UTSW 13 66917039 missense probably damaging 1.00
R1573:Mterf3 UTSW 13 66922903 missense possibly damaging 0.73
R1919:Mterf3 UTSW 13 66930062 missense probably damaging 0.97
R2327:Mterf3 UTSW 13 66928194 missense probably damaging 1.00
R5549:Mterf3 UTSW 13 66928257 missense probably benign 0.32
R6590:Mterf3 UTSW 13 66917046 missense probably damaging 1.00
R6690:Mterf3 UTSW 13 66917046 missense probably damaging 1.00
R7599:Mterf3 UTSW 13 66917148 missense probably damaging 1.00
R8297:Mterf3 UTSW 13 66907158 missense
Predicted Primers PCR Primer
(F):5'- AGCAATTCAAGGGCAATCTGAGGTG -3'
(R):5'- CTCCGGCGGGGAATTAAGACTTAC -3'

Sequencing Primer
(F):5'- CTGAGGTGTAACATAACTGTTCCC -3'
(R):5'- AAGACTTACAGGACTTTGTTCTGG -3'
Posted On2014-05-09