Incidental Mutation 'R1403:Nfkbiz'
ID188629
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
SynonymsMail
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55811375-55838899 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55816470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
Predicted Effect probably benign
Transcript: ENSMUST00000036273
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096026
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114457
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114458
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231463
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55817909 missense probably benign
IGL01324:Nfkbiz APN 16 55815804 missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55815671 missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55816351 missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55817954 missense probably benign
R0349:Nfkbiz UTSW 16 55818991 critical splice donor site probably null
R0539:Nfkbiz UTSW 16 55817879 missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55816367 missense probably damaging 1.00
R1743:Nfkbiz UTSW 16 55816394 missense possibly damaging 0.82
R2090:Nfkbiz UTSW 16 55816455 missense probably benign 0.01
R2163:Nfkbiz UTSW 16 55818218 missense probably benign 0.00
R3195:Nfkbiz UTSW 16 55819628 missense probably damaging 1.00
R3974:Nfkbiz UTSW 16 55818436 missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55816841 missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55819024 critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55818424 missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55818500 missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55819641 missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55814020 missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55821962 missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55818300 missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55821846 missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55817839 missense probably benign 0.34
R7941:Nfkbiz UTSW 16 55821944 missense probably damaging 0.98
R8193:Nfkbiz UTSW 16 55821851 missense probably damaging 0.96
R8402:Nfkbiz UTSW 16 55816387 missense probably damaging 0.98
Z1088:Nfkbiz UTSW 16 55816438 missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55818236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAACGGCTCATATCCAAGCAC -3'
(R):5'- TCACATGCTGGACATTAAGGAGCAC -3'

Sequencing Primer
(F):5'- AACAGAAGCCTGCTTTCTGG -3'
(R):5'- TCCAGTGCAGACTGTTTAAGAGC -3'
Posted On2014-05-09