Incidental Mutation 'R1403:Rbm27'
ID188632
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene NameRNA binding motif protein 27
SynonymsPsc1
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42275353-42341542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42317681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 509 (S509P)
Ref Sequence ENSEMBL: ENSMUSP00000041688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
Predicted Effect probably damaging
Transcript: ENSMUST00000046972
AA Change: S509P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491
AA Change: S509P

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091920
AA Change: S454P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491
AA Change: S454P

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42319814 missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42301840 missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42319913 missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42333399 critical splice donor site probably null
IGL03085:Rbm27 APN 18 42327524 splice site probably benign
IGL03249:Rbm27 APN 18 42301747 missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42305716 missense probably damaging 0.99
messenger UTSW 18 42333403 splice site probably null
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0111:Rbm27 UTSW 18 42305672 splice site probably benign
R0122:Rbm27 UTSW 18 42313968 intron probably benign
R0707:Rbm27 UTSW 18 42326026 critical splice donor site probably null
R1253:Rbm27 UTSW 18 42301774 missense probably damaging 0.99
R1268:Rbm27 UTSW 18 42333302 missense probably damaging 1.00
R1317:Rbm27 UTSW 18 42324051 splice site probably benign
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42325957 missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42292112 splice site probably benign
R3123:Rbm27 UTSW 18 42327165 missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42292112 splice site probably benign
R3712:Rbm27 UTSW 18 42292112 splice site probably benign
R4616:Rbm27 UTSW 18 42301775 missense probably damaging 0.96
R4839:Rbm27 UTSW 18 42327445 missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42338444 missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42327210 missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42317666 missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42300385 missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42327505 missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42333318 missense probably damaging 1.00
R6499:Rbm27 UTSW 18 42337011 missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42324113 missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42325939 missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42301864 missense probably benign 0.00
R6812:Rbm27 UTSW 18 42333403 splice site probably null
R7162:Rbm27 UTSW 18 42314027 missense unknown
R7606:Rbm27 UTSW 18 42327513 missense probably damaging 1.00
R7904:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
R7969:Rbm27 UTSW 18 42275480 start gained probably benign
R8177:Rbm27 UTSW 18 42324110 missense probably damaging 1.00
X0065:Rbm27 UTSW 18 42299320 missense possibly damaging 0.70
Z1176:Rbm27 UTSW 18 42333234 frame shift probably null
Z1177:Rbm27 UTSW 18 42338452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGTGTCTAATATAACTCACAGAGGAGTG -3'
(R):5'- CCCAGCATACAACTAAAATGGTCCGA -3'

Sequencing Primer
(F):5'- TGAAGAACACATACTTTGAACAGCTC -3'
(R):5'- gttcaaatcccagcaaccac -3'
Posted On2014-05-09