Incidental Mutation 'R1403:Aldh7a1'
ID188633
Institutional Source Beutler Lab
Gene Symbol Aldh7a1
Ensembl Gene ENSMUSG00000053644
Gene Namealdehyde dehydrogenase family 7, member A1
SynonymsD18Wsu181e, Atq1
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location56509687-56572951 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 56559269 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 87 (E87*)
Ref Sequence ENSEMBL: ENSMUSP00000133970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066208] [ENSMUST00000130163] [ENSMUST00000171844] [ENSMUST00000172734] [ENSMUST00000174518] [ENSMUST00000174704]
Predicted Effect probably null
Transcript: ENSMUST00000066208
AA Change: E89*
SMART Domains Protein: ENSMUSP00000065089
Gene: ENSMUSG00000053644
AA Change: E89*

DomainStartEndE-ValueType
Pfam:Aldedh 59 522 1.2e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130163
SMART Domains Protein: ENSMUSP00000122948
Gene: ENSMUSG00000008301

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
Pfam:RNA_GG_bind 199 282 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132628
SMART Domains Protein: ENSMUSP00000119047
Gene: ENSMUSG00000008301

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
low complexity region 64 74 N/A INTRINSIC
low complexity region 128 136 N/A INTRINSIC
Pfam:RNA_GG_bind 204 251 3.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170309
AA Change: E89*
SMART Domains Protein: ENSMUSP00000127625
Gene: ENSMUSG00000053644
AA Change: E89*

DomainStartEndE-ValueType
Pfam:Aldedh 60 155 7.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171844
AA Change: E62*
SMART Domains Protein: ENSMUSP00000127652
Gene: ENSMUSG00000053644
AA Change: E62*

DomainStartEndE-ValueType
Pfam:Aldedh 47 121 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171851
Predicted Effect probably null
Transcript: ENSMUST00000172734
AA Change: E89*
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644
AA Change: E89*

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174518
AA Change: E61*
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644
AA Change: E61*

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174704
AA Change: E87*
SMART Domains Protein: ENSMUSP00000133970
Gene: ENSMUSG00000053644
AA Change: E87*

DomainStartEndE-ValueType
Pfam:Aldedh 57 293 1.4e-54 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Aldh7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Aldh7a1 APN 18 56528355 splice site probably benign
IGL02887:Aldh7a1 APN 18 56542216 intron probably benign
R0462:Aldh7a1 UTSW 18 56534214 splice site probably null
R0595:Aldh7a1 UTSW 18 56546893 splice site probably benign
R0657:Aldh7a1 UTSW 18 56537197 splice site probably benign
R0947:Aldh7a1 UTSW 18 56560838 splice site probably null
R1295:Aldh7a1 UTSW 18 56546950 critical splice acceptor site probably null
R1385:Aldh7a1 UTSW 18 56542285 missense probably damaging 1.00
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1517:Aldh7a1 UTSW 18 56532061 missense probably damaging 0.99
R1550:Aldh7a1 UTSW 18 56550382 missense possibly damaging 0.49
R3552:Aldh7a1 UTSW 18 56550292 splice site probably null
R3953:Aldh7a1 UTSW 18 56548505 missense probably damaging 0.99
R4124:Aldh7a1 UTSW 18 56537323 intron probably benign
R4296:Aldh7a1 UTSW 18 56544963 critical splice donor site probably null
R4355:Aldh7a1 UTSW 18 56548494 missense probably null 0.09
R4549:Aldh7a1 UTSW 18 56531994 missense probably benign 0.09
R4851:Aldh7a1 UTSW 18 56532016 missense possibly damaging 0.95
R5288:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5384:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5385:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5547:Aldh7a1 UTSW 18 56528284 missense probably damaging 1.00
R6505:Aldh7a1 UTSW 18 56526996 missense probably damaging 1.00
R7373:Aldh7a1 UTSW 18 56542317 missense possibly damaging 0.48
R7861:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
R8205:Aldh7a1 UTSW 18 56544998 missense probably damaging 1.00
Z1177:Aldh7a1 UTSW 18 56526991 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCCGAGAATGCAGTTTTCAG -3'
(R):5'- CGTGAGTCTTAGGGACAGTGTCCA -3'

Sequencing Primer
(F):5'- AGAATGCAGTTTTCAGCACTTTCC -3'
(R):5'- gggtgggcaaggaacgg -3'
Posted On2014-05-09