Incidental Mutation 'R1403:Afap1l1'
Institutional Source Beutler Lab
Gene Symbol Afap1l1
Ensembl Gene ENSMUSG00000033032
Gene Nameactin filament associated protein 1-like 1
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosomal Location61730261-61786702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61741838 bp
Amino Acid Change Tyrosine to Cysteine at position 424 (Y424C)
Ref Sequence ENSEMBL: ENSMUSP00000113286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120472] [ENSMUST00000154876]
Predicted Effect probably damaging
Transcript: ENSMUST00000120472
AA Change: Y424C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113286
Gene: ENSMUSG00000033032
AA Change: Y424C

low complexity region 114 123 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
PH 221 318 4.13e-6 SMART
PH 419 514 9.41e-10 SMART
coiled coil region 611 701 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147278
Predicted Effect probably benign
Transcript: ENSMUST00000154876
Meta Mutation Damage Score 0.5538 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Afap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Afap1l1 APN 18 61736854 missense probably benign 0.04
IGL01643:Afap1l1 APN 18 61751826 missense probably damaging 1.00
IGL01754:Afap1l1 APN 18 61737494 critical splice donor site probably null
IGL01945:Afap1l1 APN 18 61756863 missense probably benign 0.00
IGL02025:Afap1l1 APN 18 61733699 splice site probably benign
IGL02413:Afap1l1 APN 18 61733789 missense probably benign 0.00
IGL02418:Afap1l1 APN 18 61752577 missense probably damaging 1.00
IGL02493:Afap1l1 APN 18 61737523 missense possibly damaging 0.83
IGL02888:Afap1l1 APN 18 61748808 missense probably damaging 1.00
IGL03010:Afap1l1 APN 18 61743319 missense probably benign 0.01
IGL03122:Afap1l1 APN 18 61733831 missense probably benign
IGL03145:Afap1l1 APN 18 61741809 missense possibly damaging 0.93
IGL03052:Afap1l1 UTSW 18 61748823 missense probably benign 0.00
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0217:Afap1l1 UTSW 18 61746869 missense probably damaging 1.00
R0421:Afap1l1 UTSW 18 61751874 missense probably damaging 1.00
R0626:Afap1l1 UTSW 18 61739220 missense probably benign 0.07
R0963:Afap1l1 UTSW 18 61736930 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1566:Afap1l1 UTSW 18 61755643 missense probably benign
R1572:Afap1l1 UTSW 18 61737499 missense probably damaging 1.00
R1854:Afap1l1 UTSW 18 61743294 missense probably benign
R1992:Afap1l1 UTSW 18 61741771 nonsense probably null
R2063:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2064:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2065:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2066:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R4120:Afap1l1 UTSW 18 61739172 missense probably damaging 1.00
R4904:Afap1l1 UTSW 18 61738715 missense probably benign 0.00
R4997:Afap1l1 UTSW 18 61751808 missense probably benign
R5379:Afap1l1 UTSW 18 61758650 missense probably damaging 1.00
R5947:Afap1l1 UTSW 18 61743700 missense probably damaging 0.98
R6774:Afap1l1 UTSW 18 61755661 missense probably benign 0.00
R6814:Afap1l1 UTSW 18 61733741 missense probably benign 0.45
R7085:Afap1l1 UTSW 18 61748814 missense possibly damaging 0.91
R7325:Afap1l1 UTSW 18 61736846 missense probably benign 0.44
R7543:Afap1l1 UTSW 18 61756901 missense probably benign 0.01
R7877:Afap1l1 UTSW 18 61746782 missense probably damaging 1.00
R8041:Afap1l1 UTSW 18 61758683 missense probably damaging 1.00
R8253:Afap1l1 UTSW 18 61741631 missense probably benign 0.43
Z1177:Afap1l1 UTSW 18 61752508 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tctccaaactttcataggaataacac -3'
Posted On2014-05-09