Mutagenetix > Incidental Mutation

Incidental Mutation 'R1404:Itga6'

188641

Institutional Source

Beutler Lab

Gene Symbol

Itga6

Ensembl Gene

ENSMUSG00000027111

Gene Name

integrin alpha 6

Synonyms

Cd49f, 5033401O05Rik

MMRRC Submission

039466-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1404 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

71745616-71858416 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71838716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 617 (T617A)

Ref Sequence

ENSEMBL: ENSMUSP00000107729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]

AlphaFold

Q61739

Predicted Effect

probably benign
Transcript: ENSMUST00000028522
AA Change: T617A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111
AA Change: T617A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	40	101	3.12e-6	SMART
Int_alpha	254	303	2.7e-1	SMART
Int_alpha	312	368	1.46e-11	SMART
Int_alpha	373	426	9.73e-17	SMART
Int_alpha	428	483	5.83e0	SMART
SCOP:d1m1xa2	629	786	5e-32	SMART
SCOP:d1m1xa3	797	1017	3e-55	SMART
Pfam:Integrin_alpha	1038	1052	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112101
AA Change: T617A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111
AA Change: T617A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Int_alpha	40	101	3.12e-6	SMART
Int_alpha	254	303	2.7e-1	SMART
Int_alpha	312	368	1.46e-11	SMART
Int_alpha	373	426	9.73e-17	SMART
Int_alpha	428	483	5.83e0	SMART
SCOP:d1m1xa2	629	786	4e-32	SMART
SCOP:d1m1xa3	797	1017	4e-55	SMART
low complexity region	1058	1070	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000155249
AA Change: T210A

SMART Domains

Protein: ENSMUSP00000118086
Gene: ENSMUSG00000027111
AA Change: T210A

Domain	Start	End	E-Value	Type
Pfam:Integrin_alpha2	58	533	4.7e-131	PFAM
transmembrane domain	609	631	N/A	INTRINSIC
Pfam:Integrin_alpha	632	646	6.2e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155596

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	A	4: 53,059,253		probably benign	Het
Actl6a	T	C	3: 32,722,610		probably benign	Het
Aox2	T	C	1: 58,346,212		probably benign	Het
Arrdc3	A	G	13: 80,883,854	T69A	probably damaging	Het
Bbs2	T	C	8: 94,081,999	K360R	probably null	Het
Cdh8	A	T	8: 99,279,618	N112K	probably damaging	Het
Ces5a	A	T	8: 93,502,181	F474I	probably damaging	Het
Doxl2	A	T	6: 48,975,833	T231S	probably benign	Het
Dync1i1	G	A	6: 5,915,876	D253N	probably damaging	Het
Fam151b	T	C	13: 92,473,972	D103G	probably damaging	Het
Fam227b	A	G	2: 126,003,839	L410P	probably damaging	Het
Ihh	A	T	1: 74,951,213	M1K	probably null	Het
Itpr1	T	A	6: 108,386,648	C744S	probably benign	Het
Kif5a	T	C	10: 127,245,442	I208V	probably benign	Het
Lama4	A	G	10: 39,061,391	K659R	probably benign	Het
Lpin3	T	A	2: 160,892,390		probably null	Het
Macf1	T	A	4: 123,376,516	E6612V	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Ncdn	T	C	4: 126,750,040	K330E	probably benign	Het
Neb	C	T	2: 52,183,275	D1975N	possibly damaging	Het
Nell1	T	A	7: 50,853,873	N675K	possibly damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Olfr1317	G	A	2: 112,142,623	R226H	probably benign	Het
Rnf43	A	G	11: 87,734,177	E737G	possibly damaging	Het
Sardh	C	A	2: 27,239,461	W275L	probably damaging	Het
Sel1l2	C	T	2: 140,230,059		probably benign	Het
Sipa1l2	G	A	8: 125,449,973	H1185Y	probably damaging	Het
Skp2	G	A	15: 9,116,925	Q298*	probably null	Het
Spag16	G	A	1: 69,895,280		probably benign	Het
Spink14	A	G	18: 44,028,829		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Stx12	T	A	4: 132,871,649	I43L	probably benign	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Tollip	T	C	7: 141,884,555	M209V	probably benign	Het
Ttn	A	T	2: 76,812,968	S13202R	probably damaging	Het
Vmn2r60	T	A	7: 42,136,787	V338D	probably damaging	Het
Vwa8	T	C	14: 79,026,031	L767P	probably damaging	Het
Zfp202	C	T	9: 40,211,496	T518I	probably damaging	Het

Other mutations in Itga6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Itga6	APN	2	71838262	splice site	probably null
IGL00902:Itga6	APN	2	71849394	missense	probably benign	0.39
IGL01360:Itga6	APN	2	71787326	splice site	probably null
IGL01621:Itga6	APN	2	71825656	missense	probably benign	0.02
IGL01877:Itga6	APN	2	71838280	missense	probably benign
IGL02332:Itga6	APN	2	71838373	missense	possibly damaging	0.63
IGL02556:Itga6	APN	2	71838683	missense	probably benign	0.20
IGL02713:Itga6	APN	2	71816713	missense	possibly damaging	0.79
IGL02811:Itga6	APN	2	71826732	missense	probably damaging	0.98
IGL03171:Itga6	APN	2	71841329	critical splice donor site	probably null
isle_royale	UTSW	2	71787233	missense	probably benign	0.04
PIT4418001:Itga6	UTSW	2	71834070	missense	probably benign	0.06
R0070:Itga6	UTSW	2	71826716	unclassified	probably benign
R0611:Itga6	UTSW	2	71820060	missense	possibly damaging	0.84
R1404:Itga6	UTSW	2	71838716	missense	probably benign
R1439:Itga6	UTSW	2	71834034	missense	probably damaging	1.00
R1487:Itga6	UTSW	2	71843240	missense	possibly damaging	0.87
R1713:Itga6	UTSW	2	71787202	missense	probably benign
R1720:Itga6	UTSW	2	71820166	missense	probably damaging	1.00
R1816:Itga6	UTSW	2	71840809	missense	probably benign	0.00
R1866:Itga6	UTSW	2	71834070	missense	probably benign
R2009:Itga6	UTSW	2	71816681	missense	probably benign	0.26
R2018:Itga6	UTSW	2	71818484	missense	probably benign	0.16
R2171:Itga6	UTSW	2	71820014	missense	probably damaging	1.00
R2189:Itga6	UTSW	2	71825617	missense	probably benign	0.00
R2289:Itga6	UTSW	2	71818529	missense	probably damaging	0.99
R2399:Itga6	UTSW	2	71820014	missense	probably damaging	1.00
R4437:Itga6	UTSW	2	71825638	missense	probably benign	0.42
R4482:Itga6	UTSW	2	71855915	missense	probably damaging	1.00
R4773:Itga6	UTSW	2	71822444	missense	probably benign	0.13
R4786:Itga6	UTSW	2	71838690	missense	possibly damaging	0.80
R4898:Itga6	UTSW	2	71838373	missense	possibly damaging	0.77
R5074:Itga6	UTSW	2	71826435	missense	probably benign
R5386:Itga6	UTSW	2	71841150	missense	probably damaging	1.00
R5591:Itga6	UTSW	2	71840590	missense	probably damaging	1.00
R6024:Itga6	UTSW	2	71787233	missense	probably benign	0.04
R6174:Itga6	UTSW	2	71833709	missense	possibly damaging	0.88
R6210:Itga6	UTSW	2	71834007	critical splice acceptor site	probably null
R6432:Itga6	UTSW	2	71833772	missense	possibly damaging	0.75
R6644:Itga6	UTSW	2	71841124	missense	probably damaging	1.00
R7354:Itga6	UTSW	2	71820230	missense	probably damaging	1.00
R7402:Itga6	UTSW	2	71853553	missense	probably benign	0.05
R7479:Itga6	UTSW	2	71838336	nonsense	probably null
R7635:Itga6	UTSW	2	71843233	missense	probably benign	0.00
R7657:Itga6	UTSW	2	71846251	missense	probably benign	0.40
R7737:Itga6	UTSW	2	71822443	missense	probably benign	0.38
R7782:Itga6	UTSW	2	71841535	missense	probably damaging	0.98
R8062:Itga6	UTSW	2	71841743	missense	probably benign	0.11
R8312:Itga6	UTSW	2	71855953	missense	probably benign
R8698:Itga6	UTSW	2	71843274	missense	probably benign
R9080:Itga6	UTSW	2	71843289	missense	probably benign
R9169:Itga6	UTSW	2	71816671	missense	possibly damaging	0.74
R9209:Itga6	UTSW	2	71841133	missense	probably benign	0.27
R9267:Itga6	UTSW	2	71838412	missense	probably benign	0.00
R9483:Itga6	UTSW	2	71849490	missense	probably benign	0.03
R9747:Itga6	UTSW	2	71826527	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTTTGCAGGAGAACATCAGAGAC -3'
(R):5'- ACAATGACCCGAGCTGCATTAGAC -3'

Sequencing Primer
(F):5'- TCAGAGACAAGCTGCGTC -3'
(R):5'- AAGGTCACCATATGTGGCCA -3'

Posted On

2014-05-09