Incidental Mutation 'R1404:Stx12'
ID188652
Institutional Source Beutler Lab
Gene Symbol Stx12
Ensembl Gene ENSMUSG00000028879
Gene Namesyntaxin 12
SynonymsStx13, syntaxin 13
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R1404 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132853501-132884509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132871649 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 43 (I43L)
Ref Sequence ENSEMBL: ENSMUSP00000030698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030698]
Predicted Effect probably benign
Transcript: ENSMUST00000030698
AA Change: I43L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030698
Gene: ENSMUSG00000028879
AA Change: I43L

DomainStartEndE-ValueType
SynN 14 129 2.7e-32 SMART
t_SNARE 173 240 4.07e-20 SMART
transmembrane domain 251 273 N/A INTRINSIC
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
Actl6a T C 3: 32,722,610 probably benign Het
Aox2 T C 1: 58,346,212 probably benign Het
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sel1l2 C T 2: 140,230,059 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Spag16 G A 1: 69,895,280 probably benign Het
Spink14 A G 18: 44,028,829 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Stx12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Stx12 APN 4 132863265 missense probably benign 0.06
IGL01484:Stx12 APN 4 132884362 missense probably damaging 0.99
IGL03073:Stx12 APN 4 132858449 missense probably benign 0.00
IGL03090:Stx12 APN 4 132863229 missense probably benign
R0433:Stx12 UTSW 4 132858430 missense probably damaging 1.00
R0725:Stx12 UTSW 4 132857390 splice site probably benign
R1404:Stx12 UTSW 4 132871649 missense probably benign
R1417:Stx12 UTSW 4 132860542 critical splice donor site probably null
R1711:Stx12 UTSW 4 132858477 missense probably damaging 1.00
R2100:Stx12 UTSW 4 132860602 missense possibly damaging 0.93
R3085:Stx12 UTSW 4 132857361 missense probably damaging 1.00
R7272:Stx12 UTSW 4 132857376 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CACGCAGGGTTATACTGACACAGC -3'
(R):5'- CTTGCAAAAGCACTGTGGAGGAATG -3'

Sequencing Primer
(F):5'- GTTATACTGACACAGCTCCCTGAG -3'
(R):5'- CACTGTGGAGGAATGTGTTTGTAAAG -3'
Posted On2014-05-09