Incidental Mutation 'R1404:Nlrp6'
ID 188658
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 039466-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1404 (G1)
Quality Score 144
Status Not validated
Chromosome 7
Chromosomal Location 140920902-140929192 bp(+) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) GAGAAGAAGAAGAAGAAGAAGA to GAGAAGAAGAAGAAGAAGA at 140924113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably benign
Transcript: ENSMUST00000106045
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000184560
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
Actl6a T C 3: 32,722,610 probably benign Het
Aox2 T C 1: 58,346,212 probably benign Het
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sel1l2 C T 2: 140,230,059 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Spag16 G A 1: 69,895,280 probably benign Het
Spink14 A G 18: 44,028,829 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2097:Nlrp6 UTSW 7 140923204 missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140921655 missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5442:Nlrp6 UTSW 7 140922190 missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140922812 nonsense probably null
R6124:Nlrp6 UTSW 7 140923247 missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140923841 missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140922830 missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140926419 missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAGCTCCTGAACTCTGACG -3'
(R):5'- ATGGGTAAAGCAGTCCTGAGGTCC -3'

Sequencing Primer
(F):5'- gaggaggaggaggaggaag -3'
(R):5'- AGTCCTGAGGTCCGCTCC -3'
Posted On 2014-05-09