Mutagenetix > Incidental Mutation

Incidental Mutation 'R1404:Tollip'

188659

Institutional Source

Beutler Lab

Gene Symbol

Tollip

Ensembl Gene

ENSMUSG00000025139

Gene Name

toll interacting protein

Synonyms

4930403G24Rik, Toll interacting protein, 4931428G15Rik

MMRRC Submission

039466-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R1404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141874813-141918507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141884555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 209 (M209V)

Ref Sequence

ENSEMBL: ENSMUSP00000117938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]

AlphaFold

Q9QZ06

Predicted Effect

probably benign
Transcript: ENSMUST00000001950
AA Change: M213V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: M213V

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
C2	54	151	1.32e-6	SMART
low complexity region	175	190	N/A	INTRINSIC
low complexity region	213	225	N/A	INTRINSIC
CUE	229	271	1.43e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000055819

SMART Domains

Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
C2	54	151	1.32e-6	SMART
low complexity region	175	190	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130439
AA Change: M209V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: M209V

Domain	Start	End	E-Value	Type
low complexity region	24	40	N/A	INTRINSIC
Pfam:C2	51	115	6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151890
AA Change: M144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: M144V

Domain	Start	End	E-Value	Type
Pfam:C2	1	66	1.9e-8	PFAM
low complexity region	106	121	N/A	INTRINSIC
low complexity region	144	156	N/A	INTRINSIC
CUE	160	202	1.43e-15	SMART

Meta Mutation Damage Score

0.0620

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	A	4: 53,059,253		probably benign	Het
Actl6a	T	C	3: 32,722,610		probably benign	Het
Aox2	T	C	1: 58,346,212		probably benign	Het
Arrdc3	A	G	13: 80,883,854	T69A	probably damaging	Het
Bbs2	T	C	8: 94,081,999	K360R	probably null	Het
Cdh8	A	T	8: 99,279,618	N112K	probably damaging	Het
Ces5a	A	T	8: 93,502,181	F474I	probably damaging	Het
Doxl2	A	T	6: 48,975,833	T231S	probably benign	Het
Dync1i1	G	A	6: 5,915,876	D253N	probably damaging	Het
Fam151b	T	C	13: 92,473,972	D103G	probably damaging	Het
Fam227b	A	G	2: 126,003,839	L410P	probably damaging	Het
Ihh	A	T	1: 74,951,213	M1K	probably null	Het
Itga6	A	G	2: 71,838,716	T617A	probably benign	Het
Itpr1	T	A	6: 108,386,648	C744S	probably benign	Het
Kif5a	T	C	10: 127,245,442	I208V	probably benign	Het
Lama4	A	G	10: 39,061,391	K659R	probably benign	Het
Lpin3	T	A	2: 160,892,390		probably null	Het
Macf1	T	A	4: 123,376,516	E6612V	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Ncdn	T	C	4: 126,750,040	K330E	probably benign	Het
Neb	C	T	2: 52,183,275	D1975N	possibly damaging	Het
Nell1	T	A	7: 50,853,873	N675K	possibly damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Olfr1317	G	A	2: 112,142,623	R226H	probably benign	Het
Rnf43	A	G	11: 87,734,177	E737G	possibly damaging	Het
Sardh	C	A	2: 27,239,461	W275L	probably damaging	Het
Sel1l2	C	T	2: 140,230,059		probably benign	Het
Sipa1l2	G	A	8: 125,449,973	H1185Y	probably damaging	Het
Skp2	G	A	15: 9,116,925	Q298*	probably null	Het
Spag16	G	A	1: 69,895,280		probably benign	Het
Spink14	A	G	18: 44,028,829		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Stx12	T	A	4: 132,871,649	I43L	probably benign	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Ttn	A	T	2: 76,812,968	S13202R	probably damaging	Het
Vmn2r60	T	A	7: 42,136,787	V338D	probably damaging	Het
Vwa8	T	C	14: 79,026,031	L767P	probably damaging	Het
Zfp202	C	T	9: 40,211,496	T518I	probably damaging	Het

Other mutations in Tollip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1404:Tollip	UTSW	7	141884555	missense	probably benign	0.00
R1742:Tollip	UTSW	7	141892855	missense	probably damaging	1.00
R2443:Tollip	UTSW	7	141890823	nonsense	probably null
R4092:Tollip	UTSW	7	141884443	missense	probably damaging	1.00
R5192:Tollip	UTSW	7	141892117	missense	probably damaging	1.00
R5614:Tollip	UTSW	7	141892088	missense	probably damaging	1.00
R6132:Tollip	UTSW	7	141889597	missense	probably benign	0.37
R6805:Tollip	UTSW	7	141890845	missense	probably benign	0.21
R6830:Tollip	UTSW	7	141898714	start codon destroyed	probably null	0.00
R7366:Tollip	UTSW	7	141889597	missense	probably benign	0.37
R7509:Tollip	UTSW	7	141892141	missense	probably benign	0.36
R7759:Tollip	UTSW	7	141884539	missense	probably benign
R8024:Tollip	UTSW	7	141892826	missense	probably benign
R9574:Tollip	UTSW	7	141891994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATTGATGGCAGCATCTTTGTTCCC -3'
(R):5'- CCAGTCAGATTAAGGTAGCCTTTTCCC -3'

Sequencing Primer
(F):5'- CTCTCTGGGCTTCAAGCAC -3'
(R):5'- GATCCCACTGTCTctgtcctg -3'

Posted On

2014-05-09