Mutagenetix > Incidental Mutation

Incidental Mutation 'R1404:Ces5a'

188660

Institutional Source

Beutler Lab

Gene Symbol

Ces5a

Ensembl Gene

ENSMUSG00000058019

Gene Name

carboxylesterase 5A

Synonyms

Ces7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin

MMRRC Submission

039466-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R1404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93499064-93535830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93502181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 474 (F474I)

Ref Sequence

ENSEMBL: ENSMUSP00000148481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009]

AlphaFold

Q6AW46

Predicted Effect

probably damaging
Transcript: ENSMUST00000077816
AA Change: F474I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: F474I

Domain	Start	End	E-Value	Type
Pfam:COesterase	10	539	3.2e-157	PFAM
Pfam:Abhydrolase_3	141	238	9.5e-7	PFAM
low complexity region	552	575	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000080391

SMART Domains

Protein: ENSMUSP00000079254
Gene: ENSMUSG00000058019

Domain	Start	End	E-Value	Type
Pfam:COesterase	83	208	2.3e-23	PFAM
low complexity region	221	244	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212009
AA Change: F474I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212690

Meta Mutation Damage Score

0.3291

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	A	4: 53,059,253		probably benign	Het
Actl6a	T	C	3: 32,722,610		probably benign	Het
Aox2	T	C	1: 58,346,212		probably benign	Het
Arrdc3	A	G	13: 80,883,854	T69A	probably damaging	Het
Bbs2	T	C	8: 94,081,999	K360R	probably null	Het
Cdh8	A	T	8: 99,279,618	N112K	probably damaging	Het
Doxl2	A	T	6: 48,975,833	T231S	probably benign	Het
Dync1i1	G	A	6: 5,915,876	D253N	probably damaging	Het
Fam151b	T	C	13: 92,473,972	D103G	probably damaging	Het
Fam227b	A	G	2: 126,003,839	L410P	probably damaging	Het
Ihh	A	T	1: 74,951,213	M1K	probably null	Het
Itga6	A	G	2: 71,838,716	T617A	probably benign	Het
Itpr1	T	A	6: 108,386,648	C744S	probably benign	Het
Kif5a	T	C	10: 127,245,442	I208V	probably benign	Het
Lama4	A	G	10: 39,061,391	K659R	probably benign	Het
Lpin3	T	A	2: 160,892,390		probably null	Het
Macf1	T	A	4: 123,376,516	E6612V	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Ncdn	T	C	4: 126,750,040	K330E	probably benign	Het
Neb	C	T	2: 52,183,275	D1975N	possibly damaging	Het
Nell1	T	A	7: 50,853,873	N675K	possibly damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Olfr1317	G	A	2: 112,142,623	R226H	probably benign	Het
Rnf43	A	G	11: 87,734,177	E737G	possibly damaging	Het
Sardh	C	A	2: 27,239,461	W275L	probably damaging	Het
Sel1l2	C	T	2: 140,230,059		probably benign	Het
Sipa1l2	G	A	8: 125,449,973	H1185Y	probably damaging	Het
Skp2	G	A	15: 9,116,925	Q298*	probably null	Het
Spag16	G	A	1: 69,895,280		probably benign	Het
Spink14	A	G	18: 44,028,829		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Stx12	T	A	4: 132,871,649	I43L	probably benign	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Tollip	T	C	7: 141,884,555	M209V	probably benign	Het
Ttn	A	T	2: 76,812,968	S13202R	probably damaging	Het
Vmn2r60	T	A	7: 42,136,787	V338D	probably damaging	Het
Vwa8	T	C	14: 79,026,031	L767P	probably damaging	Het
Zfp202	C	T	9: 40,211,496	T518I	probably damaging	Het

Other mutations in Ces5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Ces5a	APN	8	93525544	critical splice donor site	probably null
IGL01520:Ces5a	APN	8	93519578	missense	probably benign	0.08
IGL01674:Ces5a	APN	8	93502219	missense	probably damaging	1.00
IGL02257:Ces5a	APN	8	93525598	missense	probably benign	0.00
IGL02456:Ces5a	APN	8	93528644	splice site	probably benign
IGL03027:Ces5a	APN	8	93523114	splice site	probably null
IGL03051:Ces5a	APN	8	93528598	missense	probably damaging	1.00
IGL03264:Ces5a	APN	8	93502270	missense	possibly damaging	0.74
IGL03290:Ces5a	APN	8	93519632	missense	probably damaging	1.00
R0115:Ces5a	UTSW	8	93502183	missense	probably damaging	0.98
R0124:Ces5a	UTSW	8	93528555	missense	probably damaging	1.00
R0521:Ces5a	UTSW	8	93525658	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1524:Ces5a	UTSW	8	93525665	missense	probably damaging	0.96
R1843:Ces5a	UTSW	8	93514231	missense	probably damaging	1.00
R2029:Ces5a	UTSW	8	93534577	missense	probably damaging	1.00
R2135:Ces5a	UTSW	8	93499741	missense	probably benign	0.33
R2146:Ces5a	UTSW	8	93534699	missense	probably benign	0.03
R2973:Ces5a	UTSW	8	93528504	missense	probably damaging	1.00
R3755:Ces5a	UTSW	8	93528502	missense	probably benign	0.15
R4755:Ces5a	UTSW	8	93535677	missense	probably benign	0.39
R5072:Ces5a	UTSW	8	93534668	missense	probably damaging	1.00
R5278:Ces5a	UTSW	8	93525638	missense	probably damaging	1.00
R5419:Ces5a	UTSW	8	93499431	missense	unknown
R5825:Ces5a	UTSW	8	93525667	missense	probably damaging	1.00
R6318:Ces5a	UTSW	8	93534583	missense	probably damaging	1.00
R6925:Ces5a	UTSW	8	93523057	splice site	probably null
R6950:Ces5a	UTSW	8	93530774	missense	probably benign	0.10
R7148:Ces5a	UTSW	8	93502322	missense	probably damaging	1.00
R7256:Ces5a	UTSW	8	93499526	missense	probably benign	0.13
R7290:Ces5a	UTSW	8	93534683	missense	probably damaging	1.00
R7459:Ces5a	UTSW	8	93535741	start gained	probably benign
R7674:Ces5a	UTSW	8	93514269	missense	probably damaging	1.00
R7815:Ces5a	UTSW	8	93520995	missense	possibly damaging	0.79
R8150:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R8771:Ces5a	UTSW	8	93528621	missense	possibly damaging	0.85
R9502:Ces5a	UTSW	8	93535680	nonsense	probably null
R9518:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R9745:Ces5a	UTSW	8	93502186	missense	probably damaging	0.97
X0024:Ces5a	UTSW	8	93514213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATATGAAATCCCATCCGCTCAG -3'
(R):5'- ACTAGGGGTAAGGTGACTGCCATAG -3'

Sequencing Primer
(F):5'- GCGCTCAGCTCTTACTGAC -3'
(R):5'- aggaaggtaggcaggcag -3'

Posted On

2014-05-09