Incidental Mutation 'R1404:Lama4'
ID 188665
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Name laminin, alpha 4
Synonyms laminin [a]4
MMRRC Submission 039466-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1404 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 38965515-39110188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39061391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 659 (K659R)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
AlphaFold P97927
Predicted Effect probably benign
Transcript: ENSMUST00000019992
AA Change: K659R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: K659R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161992
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
Actl6a T C 3: 32,722,610 probably benign Het
Aox2 T C 1: 58,346,212 probably benign Het
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sel1l2 C T 2: 140,230,059 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Spag16 G A 1: 69,895,280 probably benign Het
Spink14 A G 18: 44,028,829 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
BB006:Lama4 UTSW 10 39078847 missense probably damaging 1.00
BB016:Lama4 UTSW 10 39078847 missense probably damaging 1.00
PIT4585001:Lama4 UTSW 10 39074746 missense probably damaging 1.00
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1443:Lama4 UTSW 10 39073643 missense probably damaging 1.00
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1616:Lama4 UTSW 10 39075450 missense probably damaging 1.00
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1768:Lama4 UTSW 10 39103501 missense possibly damaging 0.82
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4151:Lama4 UTSW 10 39005428 missense probably benign 0.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 splice site probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
R7040:Lama4 UTSW 10 39060162 missense possibly damaging 0.69
R7139:Lama4 UTSW 10 39075495 missense probably damaging 1.00
R7188:Lama4 UTSW 10 38965733 start gained probably benign
R7189:Lama4 UTSW 10 38965733 start gained probably benign
R7199:Lama4 UTSW 10 39080540 missense possibly damaging 0.84
R7211:Lama4 UTSW 10 39005495 missense probably damaging 0.98
R7262:Lama4 UTSW 10 39094934 missense probably damaging 1.00
R7274:Lama4 UTSW 10 39092299 missense probably benign 0.00
R7311:Lama4 UTSW 10 39026635 missense probably damaging 1.00
R7391:Lama4 UTSW 10 39087387 critical splice donor site probably null
R7399:Lama4 UTSW 10 39047948 missense probably damaging 0.98
R7426:Lama4 UTSW 10 39045755 missense possibly damaging 0.82
R7472:Lama4 UTSW 10 39087373 missense possibly damaging 0.65
R7635:Lama4 UTSW 10 39092188 missense probably benign
R7775:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7805:Lama4 UTSW 10 39026751 critical splice donor site probably null
R7885:Lama4 UTSW 10 39088844 missense probably benign 0.01
R7895:Lama4 UTSW 10 39088329 missense probably damaging 0.96
R7910:Lama4 UTSW 10 39070009 missense probably damaging 0.99
R7929:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7952:Lama4 UTSW 10 39030490 missense probably benign 0.39
R7991:Lama4 UTSW 10 39045809 missense possibly damaging 0.70
R8059:Lama4 UTSW 10 38966061 missense probably benign 0.00
R8194:Lama4 UTSW 10 39078720 missense probably damaging 0.99
R8248:Lama4 UTSW 10 39061379 missense possibly damaging 0.82
R8252:Lama4 UTSW 10 39060146 missense probably benign 0.00
R8265:Lama4 UTSW 10 39105204 missense probably damaging 1.00
R8275:Lama4 UTSW 10 39072811 missense probably damaging 1.00
R8426:Lama4 UTSW 10 39103491 missense probably damaging 0.98
R8434:Lama4 UTSW 10 39026707 missense possibly damaging 0.92
R8720:Lama4 UTSW 10 39095083 missense probably damaging 0.97
R8792:Lama4 UTSW 10 39048052 missense probably benign 0.00
R8836:Lama4 UTSW 10 39026591 missense probably damaging 1.00
R8867:Lama4 UTSW 10 39048000 missense probably damaging 1.00
R8892:Lama4 UTSW 10 39097198 missense probably damaging 1.00
R8913:Lama4 UTSW 10 39106043 missense probably benign 0.10
R9129:Lama4 UTSW 10 39056891 missense probably benign
R9177:Lama4 UTSW 10 39074692 missense probably damaging 0.98
R9187:Lama4 UTSW 10 39048128 critical splice donor site probably null
R9193:Lama4 UTSW 10 39075448 missense probably benign 0.03
R9268:Lama4 UTSW 10 39074692 missense probably damaging 0.98
R9287:Lama4 UTSW 10 39105964 missense probably damaging 1.00
R9295:Lama4 UTSW 10 39072751 missense probably damaging 1.00
R9303:Lama4 UTSW 10 39097141 missense probably damaging 0.99
R9330:Lama4 UTSW 10 39078726 missense probably damaging 0.99
R9430:Lama4 UTSW 10 39045806 missense probably null
R9572:Lama4 UTSW 10 39083275 missense probably damaging 1.00
R9636:Lama4 UTSW 10 39080504 missense possibly damaging 0.67
R9663:Lama4 UTSW 10 39047948 missense probably damaging 0.98
R9777:Lama4 UTSW 10 39048105 missense probably benign 0.00
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Z1177:Lama4 UTSW 10 39005424 nonsense probably null
Z1177:Lama4 UTSW 10 39005425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGAAGCTGCGTGACGTTTG -3'
(R):5'- TGCTGTTTTCCTGCATGGAAGCTC -3'

Sequencing Primer
(F):5'- GCTTCGTGTTGAGCAGATAAATG -3'
(R):5'- GCATGGAAGCTCTTTCTGAATC -3'
Posted On 2014-05-09