Incidental Mutation 'R1405:Arap1'
List |< first << previous [record 19 of 291] next >> last >|
ID188690
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
SynonymsCentd2, 2410002L19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101348067-101412586 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 101398436 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010] [ENSMUST00000155754]
Predicted Effect probably null
Transcript: ENSMUST00000084895
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084896
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098243
SMART Domains Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
PH 32 140 1.23e-13 SMART
PH 150 244 1.08e0 SMART
RhoGAP 256 438 1.35e-63 SMART
Pfam:RA 460 549 1.2e-11 PFAM
PH 563 675 8.58e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107010
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153340
Predicted Effect probably null
Transcript: ENSMUST00000154239
Predicted Effect probably benign
Transcript: ENSMUST00000155754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc138 T A 10: 58,545,117 probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101388622 missense probably benign
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4034:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R4942:Arap1 UTSW 7 101401802 missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5367:Arap1 UTSW 7 101409130 missense probably damaging 0.99
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ACTCAGTCGTTCCTGGTCTCCAAG -3'
(R):5'- AAACAGGTACAGCCGTTCTCCCTC -3'

Sequencing Primer
(F):5'- GAGTGCTTTTCAGCCAGC -3'
(R):5'- TCAAAGGTGTGCTCAAAGCTAC -3'
Posted On2014-05-09