Incidental Mutation 'R1405:Ipo7'
Institutional Source Beutler Lab
Gene Symbol Ipo7
Ensembl Gene ENSMUSG00000066232
Gene Nameimportin 7
SynonymsA330055O14Rik, Imp7, RanBP7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosomal Location110018274-110056609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110029841 bp
Amino Acid Change Isoleucine to Threonine at position 106 (I106T)
Ref Sequence ENSEMBL: ENSMUSP00000081782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]
Predicted Effect probably benign
Transcript: ENSMUST00000084731
AA Change: I106T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: I106T

IBN_N 22 101 3.06e-15 SMART
Pfam:Cse1 168 452 2.8e-12 PFAM
low complexity region 701 712 N/A INTRINSIC
low complexity region 881 900 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208821
Predicted Effect probably benign
Transcript: ENSMUST00000208951
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc138 T A 10: 58,545,117 probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Ipo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ipo7 APN 7 110029848 intron probably benign
IGL02472:Ipo7 APN 7 110040853 missense probably damaging 1.00
IGL02502:Ipo7 APN 7 110051050 missense probably damaging 1.00
IGL02514:Ipo7 APN 7 110048828 missense possibly damaging 0.78
IGL02535:Ipo7 APN 7 110054026 missense probably damaging 0.98
IGL02961:Ipo7 APN 7 110047016 missense probably benign 0.02
R0089:Ipo7 UTSW 7 110050765 intron probably benign
R0355:Ipo7 UTSW 7 110049661 missense probably benign 0.00
R0565:Ipo7 UTSW 7 110049593 intron probably benign
R1342:Ipo7 UTSW 7 110029804 missense possibly damaging 0.82
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1791:Ipo7 UTSW 7 110027132 missense probably damaging 0.98
R1838:Ipo7 UTSW 7 110042109 missense probably damaging 1.00
R2116:Ipo7 UTSW 7 110051118 missense probably damaging 0.99
R2120:Ipo7 UTSW 7 110049631 missense probably damaging 1.00
R4366:Ipo7 UTSW 7 110029712 missense possibly damaging 0.58
R4366:Ipo7 UTSW 7 110048216 missense possibly damaging 0.88
R4805:Ipo7 UTSW 7 110051484 missense probably benign 0.16
R5228:Ipo7 UTSW 7 110046762 missense probably benign 0.00
R5903:Ipo7 UTSW 7 110050813 missense probably damaging 1.00
R5976:Ipo7 UTSW 7 110048807 missense probably damaging 1.00
R6254:Ipo7 UTSW 7 110049060 missense probably benign 0.00
R6335:Ipo7 UTSW 7 110018468 missense possibly damaging 0.92
R6360:Ipo7 UTSW 7 110027129 missense probably damaging 1.00
R6776:Ipo7 UTSW 7 110047065 missense probably damaging 0.98
R7132:Ipo7 UTSW 7 110054047 missense probably benign 0.17
R7329:Ipo7 UTSW 7 110049017 missense possibly damaging 0.94
R7491:Ipo7 UTSW 7 110039194 missense possibly damaging 0.91
R7763:Ipo7 UTSW 7 110052799 missense possibly damaging 0.62
R8070:Ipo7 UTSW 7 110052807 missense probably benign 0.01
RF017:Ipo7 UTSW 7 110048794 missense probably benign 0.00
X0062:Ipo7 UTSW 7 110052886 missense probably damaging 1.00
X0066:Ipo7 UTSW 7 110052734 missense probably damaging 0.97
Predicted Primers PCR Primer
(R):5'- GCACCTCTAAAATTAggtggcgca -3'

Sequencing Primer
(F):5'- gcacccggctatgttttatttttc -3'
(R):5'- tgggaggcagagacagg -3'
Posted On2014-05-09