Incidental Mutation 'R1405:Cul9'
ID188716
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 46522175 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 1326 (A1326P)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably damaging
Transcript: ENSMUST00000066026
AA Change: A1326P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: A1326P

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182315
Predicted Effect probably damaging
Transcript: ENSMUST00000182485
AA Change: A1326P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: A1326P

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183078
Meta Mutation Damage Score 0.2264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc138 T A 10: 58,545,117 probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7917:Cul9 UTSW 17 46525704 splice site probably null
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Z1176:Cul9 UTSW 17 46520576 nonsense probably null
Z1176:Cul9 UTSW 17 46520585 nonsense probably null
Z1177:Cul9 UTSW 17 46537797 missense not run
Predicted Primers PCR Primer
(F):5'- TACATGGCCGGATTAAAGGCGGAC -3'
(R):5'- CTGTCAGGTAAACGTGATGCCCTC -3'

Sequencing Primer
(F):5'- GATTAAAGGCGGACTCCCTC -3'
(R):5'- TGGACATTAGCCAGAGTTCC -3'
Posted On2014-05-09