Incidental Mutation 'R1406:Pask'
ID188719
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene NamePAS domain containing serine/threonine kinase
SynonymsPaskin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93308770-93343482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93321651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 676 (Y676H)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
Predicted Effect probably benign
Transcript: ENSMUST00000027493
AA Change: Y676H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: Y676H

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327412 missense probably damaging 1.00
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R0863:Pask UTSW 1 93314339 missense probably damaging 1.00
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4111:Pask UTSW 1 93310818 missense probably damaging 1.00
R4514:Pask UTSW 1 93322133 missense probably benign 0.03
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7161:Pask UTSW 1 93310905 missense probably benign
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Z1177:Pask UTSW 1 93335732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCCCAGATTTCCCTCACAG -3'
(R):5'- TCCTTCAGCAGCAGAGAGCTACAG -3'

Sequencing Primer
(F):5'- CTCACAGCTTGACTTGGATAACTG -3'
(R):5'- GGATGCAAAACTGTTTGCTTC -3'
Posted On2014-05-09