Incidental Mutation 'R1406:Stk25'
ID188720
Institutional Source Beutler Lab
Gene Symbol Stk25
Ensembl Gene ENSMUSG00000026277
Gene Nameserine/threonine kinase 25 (yeast)
Synonyms1500019J11Rik, SOK-1, Ste20-like, Ysk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93619751-93658659 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 93625153 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301] [ENSMUST00000133769] [ENSMUST00000186287]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120301
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125778
Predicted Effect probably benign
Transcript: ENSMUST00000133769
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154008
Predicted Effect probably benign
Transcript: ENSMUST00000186287
SMART Domains Protein: ENSMUSP00000140396
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
STYKc 20 107 1.9e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Germ line null mutants display normal cortical layers and neuronal migration. Acute loss of expression results in impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Stk25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Stk25 APN 1 93623423 unclassified probably null
IGL02952:Stk25 APN 1 93626076 missense probably damaging 1.00
IGL03144:Stk25 APN 1 93629136 missense probably damaging 1.00
ANU05:Stk25 UTSW 1 93623423 unclassified probably null
IGL02980:Stk25 UTSW 1 93627668 missense probably damaging 1.00
PIT4531001:Stk25 UTSW 1 93624624 missense probably benign
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0555:Stk25 UTSW 1 93624591 missense probably benign 0.00
R1178:Stk25 UTSW 1 93623389 unclassified probably benign
R1493:Stk25 UTSW 1 93625600 missense probably benign 0.04
R2875:Stk25 UTSW 1 93629251 missense possibly damaging 0.91
R4657:Stk25 UTSW 1 93625656 unclassified probably benign
R4668:Stk25 UTSW 1 93625483 missense probably damaging 1.00
R4686:Stk25 UTSW 1 93623420 unclassified probably null
R5089:Stk25 UTSW 1 93624608 missense probably benign 0.05
R5493:Stk25 UTSW 1 93635309 missense probably benign
R6013:Stk25 UTSW 1 93625459 critical splice donor site probably null
X0063:Stk25 UTSW 1 93625961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCTGCCCCAGGAAAAGTGAG -3'
(R):5'- GGGCTTGGTTACTACAGTGGGAAC -3'

Sequencing Primer
(F):5'- GGCGGGCTGGTACATATGG -3'
(R):5'- ACTACAGTGGGAACTTGTACTGG -3'
Posted On2014-05-09