Incidental Mutation 'R1406:Caprin1'
ID188725
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103775987 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 303 (F303L)
Ref Sequence ENSEMBL: ENSMUSP00000106777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect probably benign
Transcript: ENSMUST00000028607
AA Change: F303L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: F303L

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111147
AA Change: F303L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: F303L

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141750
Predicted Effect unknown
Transcript: ENSMUST00000143188
AA Change: F115L
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184
AA Change: F115L

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143349
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149175
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 unclassified probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R2945:Caprin1 UTSW 2 103772809 missense probably benign 0.04
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6108:Caprin1 UTSW 2 103776017 missense possibly damaging 0.93
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7624:Caprin1 UTSW 2 103772677 missense possibly damaging 0.81
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGGATCTGACTGAGCCACTG -3'
(R):5'- AACTTTAGAACCTGAGCCAGCGG -3'

Sequencing Primer
(F):5'- CTGAGCCACTGGAGTCAAAG -3'
(R):5'- CTGAGCCAGCGGAAGAATAC -3'
Posted On2014-05-09